UNIT ONE:



UNIT ONE: Experiments

A. Scientific Method Terms:

Observation: act of perceiving, what is seen or measured.

Inference: conclusion based on observation or evidence.

Hypothesis: educated guess; untested prediction;

(“if - then” statement).

Theory: A broad explanation of natural events that is supported by strong evidence.

B. Graphing: Bar

[pic]

Graphing: Line

[pic]

C. Controlled Experiment: Compares the results of an experiment between two (or more) groups.

1. Experimental group: Group being tested or receiving treatment. (Ex: new drug)

2. Control group: “Normal” group. Should be identical to experimental group in every way

Except one, it does not receive the treatment given to the experimental group.

3. Placebo: A fake treatment given to the control group so subjects do not know which group they are in.

4. Independent Variable: Variable that is being tested. In a graph the independent variable is always plotted on the X-axis.

5. Dependent Variable: Variable that is measured at the end of an experiment; the results the dependent variable is always plotted on the Y-axis.

D. Characteristics of a good experiment.

1. Can be repeated by anyone and get the same results.

2. Have large sample size/many test subjects.

3. Are performed for longer periods of time.

4. Test only one variable.

5. Are peer reviewed –examined by several scientists to determine its accuracy.

6. Does not have to agree with the hypothesis. A scientist’s guess is allowed to be incorrect – and usually is.

7. Is objective –the experiment and conclusion are fair and unbiased. Fact and opinion are not mixed.

UNIT TWO: Maintenance

A. All living things must maintain homeostasis.

1. To maintain homeostasis, organisms carry out the same basic life functions: nutrition (ingestion, digestion, and egestion), excretion (remove wastes), transport (Passive –diffusion, osmosis and Active), respiration (makes ATP – energy, aerobic and anaerobic), growth (increase in size or

Cell #), synthesis (make or build), regulation (control and coordinate) and reproduction

(asexual and sexual).

2. All life processes make up an organism’s metabolism.

3. Failure to maintain homeostasis causes disease and death.

B. Nutrition:

1. Autotrophs make their own food, while heterotrophs eat other organisms.

2. Photosynthesis is carried out by plants, alga and blue-green bacteria (autotrophs). It takes the radiant energy of the sun and puts it in the bonds of sugar molecules.

[pic]

Photosynthesis occurs mostly in the chloroplast of plant cells.

[pic]

CO2 + H2O ( C6H12O6 + O2

a. Plants have stomates; small holes in their leaves that let them exchange the gasses

used in photosynthesis. Guard cells (X) open and close the stomates (openings between the guard cells). [pic]

[pic]

C. Respiration: Organisms get energy by breaking the bonds of sugar molecules. The released energy is used to make a molecule of ATP, which gives all organisms their energy.

1. Anaerobic (no oxygen), which yields only (2) ATP for a molecule of sugar.

2. Aerobic respiration requires oxygen and takes place in the mitochondria, and yields more (36) ATP (energy) for a molecule of sugar.

[pic]

Cellular respiration:

C6H12O6 + O2

( CO2 + H2O + ATP

3. Photosynthesis and Aerobic Respiration are opposite reactions! They are also important in cycling oxygen, carbon, hydrogen and water through the environment.

D. Transport:

1. Diffusion: movement of molecules from high concentrations to low concentrations. Requires no energy (passive transport).

[pic]

2. Osmosis is the diffusion of water into or out of the cell. If water diffuses into the cell, the cell swells (get larger) and may burst. If it loses water (being put in salt water for example) it will shrivel up

[pic]

3. Active Transport requires the use of energy (ATP), usually moving molecules from a low

concentration to a high concentration.

[pic]

E. Regulation: coordination and control of other life functions.

1. A stimulus is a change in the environment that you respond to.

2. A neuron is a nerve cell.

[pic]

3. An impulse is the electrical signal carried by the nerves. Neurotransmitters are chemicals that help carry the impulse.

4. A hormone is a chemical signal secreted by different glands in the body. Examples of hormones include insulin, adrenaline, testosterone and estrogen

5. Receptor molecules are proteins on the surface of the cell membrane that receive signals from the nervous and endocrine system. These are needed for your cells to communicate and work together.

Cellular communication illustrated in diagram below.

[pic]

F. Chemistry

1. The most common elements in living things are (in order) Carbon, Hydrogen, Oxygen and Nitrogen (CHON).

2. Organic Compounds have Carbon AND Hydrogen (ex: C6H12O6 is organic, H2O, CO2, and NH3 are not). Organic molecules are also larger than inorganic molecules.

3. Carbohydrates are sugars and starches. All carbohydrates are made from simple sugars

(like glucose) and they supply energy.

4. Lipids store energy and include fats, oils and waxes. They are made from fatty acids and glycerol.

5. Proteins are made from amino acids. Proteins also make hormones and many body and cell structures, so as far as your body is concerned; proteins are by far the most important of these three

organic molecules.

a. It is the SHAPE of proteins and how they fit together that determines what

proteins can do.

b. Four specific jobs of proteins:

1) make enzymes

[pic]

2) Make receptor molecules on the cell membrane. These are used to receive chemical messages (like hormones).

3) Make antibodies

4) Make hormones

c. Enzymes are catalysts– they affect the rates of chemical reactions.

1) Lock and key model– one type of enzyme fits one type of molecule. Change its

shape and the enzyme will no longer work.

[pic]

2) High temperatures cause proteins and enzymes to lose their shape so that they no longer work properly. This is why high fevers are dangerous.

6. pH: The pH scale measures the strengths of acids and bases. A low pH (0-6.9) is an acid, a high pH (7.1-14) is a base, and 7 is neutral (water).

G. Cells- Cells are the basic unit of life. All living things (except viruses) are made of cells.

1. Cell theory

a. All cells come from preexisting cells.

b. Cells are the basic unit of structure and function.

2. The differences between plant and animal cells are:

Plant cells have cell walls, large vacuoles, and usually rectangular shape.

Animal cells have centrioles and lack cell wall

[pic]

3. You must know the following organelles: cell membrane, cell wall, nucleus, chloroplast, cytoplasm, ribosome, vacuole, and mitochondria

4. The cell membrane is made of lipids and proteins. It shows selective permeability – that is only some molecules can pass through it (typically small molecules like water and oxygen).

[pic]

Large molecules (like starch or protein) need to be moved by active transport.

a. NOTE: Students often assume cells have a cell wall OR a cell membrane. ALL cells

have a cell membrane, including those with cell walls (plants, fungi, some bacteria and protists). The cell wall is mostly for protection; the cell membrane is needed to control

movement into and out of the cell. The animal kingdom is the only kingdom that

completely lacks cell walls.

H. Classification-

1. Organisms are classified mostly by evolutionary history. Those with common ancestors are grouped together.

2. Kingdoms are large groups of related organisms (fungi, bacteria, protists, animals, plants).

3. A species is able to successfully reproduce amongst its members.

4. A scientific name is made up of an organism’s Genus and species.

UNIT THREE: Human Body

A. Organization:

1. Cells are specialized into tissues.

a. Tissues are groups of cells specialized to do certain jobs. Examples of tissues include

muscle tissue and nerve tissue.

b. Specialization or differentiation occurs because only some genes in the nucleus of a cell are “turned on”. Almost every cell has a complete set of genes, but on those needed for the cells particular job are active. So while a red blood cell has all the genetic information

needed to make nerves cells, bone cells and skin cells, all those genes are turned off, and

only the red blood cell genes are turned on.

2. Tissues work together to form organs (heart, lungs, kidney).

3. Organs work together in organ systems (digestive system, nervous system, etc).

B. Digestive System:

1. Food is broken down so that it is small enough to enter the body tissues/cells.

2. The digestive system is a one-way passage through the body that includes the mouth,

stomach and intestines.

3. Food is moved through the digestive system by muscular contractions (peristalsis).

4. Food is broken down mechanically and chemically.

5. Undigested food is eliminated as solid waste. This is not excretion.

[pic]

C. Transport (Blood) / Circulatory System.

1. Moves material (water, nutrients, hormones, wastes) through the body.

2. Red blood cells carry oxygen (erythrocytes). White blood cells fight disease (5 kinds).

3. Plasma is the fluid of the blood. It transports everything except oxygen.

4. Platelets clot the blood.

[pic]

D. Immune System:

1. The job of the immune system is to protect the body against pathogens.

a. Types of pathogens include viruses, bacteria, and parasites.

2. White Blood Cells are the main components of the immune system. Some WBC’s - are phagocytic (engulf pathogens) others produce antibodies.

3. Antigens cause an immune response. Antibodies are proteins made by white blood cells to attack antigens. Each antibody attacks a specific antigen as determined by its shape.

4. Your body’s immune system rejects organ transplants because it recognizes the new organ as foreign and may launch an attack against it. Immunosupressant drugs may be used to lessen the immune system.

5. Blood type O is a universal donor; type AB is the universal acceptor. Blood types differ because of antigens on RBC’s and antibodies in the plasma.

[pic]

6. A vaccines an injection of a dead or weakened pathogen. This causes the body to make

antibodies against that pathogen. Vaccines only prevent diseases. They are not cures.

7. Antibiotics are drugs used to stop infections by bacteria. Antibiotics will not work

against viruses.

E. Respiratory System:

1. Physical respiration (breathing) provides oxygen needed for chemical respiration (which releases energy from sugar).

2. The diaphragm is the muscle that allows breathing to occur.

3. You breathe faster when CO2 builds up in the blood (not when you need oxygen). The medulla recognizes the CO2 build up.

4. The alveoli are very important because it is here that the oxygen enters the blood and CO2 leaves. The alveoli took like microscopic sacs surrounded by capillaries.

[pic]

F. Excretory System:

5. Removes metabolic waste from your body.

6. Your body excretes salt, water, urea and CO2.

7. Lungs excrete CO2 and water and the skin excretes sweat.

8. The kidneys filter waste from blood and reabsorb nutrients.

9. The liver filters toxins and dead red blood cells from the blood.

[pic]

F. Skeletal Muscle System

1. Know the function of bones (act as levers, attachment for muscles), bone marrow (make blood cells), cartilage (cushion between bones, new babies are mostly), tendons (connect muscles to bones) and ligaments (connect bones to bones).

2. Muscles only pull and must work in pairs.

[pic]

G. The Nervous System

1. The nervous system regulates your body along with the endocrine system.

2. Know the three parts of the brain: cerebrum (thought memory, voluntary actions), cerebellum (motor activities, balance), and medulla (involuntary actions, like breathing and respiration rate).

3. The spinal cord controls reflexes and brings impulses from the nerves to the brain.

Endocrine System:

[pic]

4. Regulates body along with nervous system. Slower but with longer lasting effects.

5. The pancreas makes insulin and glucagon which control blood sugar.

6. Adrenal glands make adrenaline when the body is under stress.

7. Testosterone (male), estrogen and progesterone (female) are the sex hormones.

8. Hormone levels are controlled by negative feedback.

H. Interaction between Systems:

1. Be able to explain how different systems of the body work together to maintain

homeostasis.

Ex: Nutrients from the digestive system are transported to cells by the circulatory system.

Wastes from respiration are removed by the excretory system.

The nervous and endocrine systems work together to control the body.

I. Diseases and Disorders:

1. Diseases and disorders: Heart attack, stroke, cancer, Down’s syndrome, diabetes, cystic fibrosis, sickle cell anemia, diarrhea, ulcers, AIDS, goiter, scurvy, rabies, meningitis, pneumonia, asthma, bronchitis, flu

2. Causes of diseases (Pathogens):

a. viruses (AIDS, cold, flu, chicken pox)

b. bacteria (strep throat, food poisoning, syphilis)

c. fungus (athlete’s foot, ringworm)

d. parasites (tapeworm, leeches)

e. genetic disorders (Down’s Syndrome, sickle cell, cystic fibrosis)

f. environmental toxins (lead poisoning, radiation)

g. poor nutrition (Scurvy, goiter)

h. organ malfunction (heart attack, diabetes)

i. high risk behavior (smoking, drug use, exposure to sun)

UNIT FOUR: Reproduction

A. Asexual reproduction:

1. Advantages: faster, easier

2. Disadvantage: no variety. Offspring are the same as parent.

[pic]

[pic]

3. Clones

B. Sexual reproduction:

1. Advantage: variety

2. Disadvantage: more time, effort and risk.

C. Mitosis

[pic]

1. Asexual

2. One division => two identical, diploid (2n) cells.

3. Chromosome number in the daughter cells is the same as in the parent cell.

4. Large organisms use mitosis for growth and healing. Simple organisms use it to

reproduce.

D. Meiosis

1. Sexual reproduction

2. One cell divides twice to make four DIFFERENT cells.

3. All 4 cells are haploid (n) meaning they have half the number of chromosomes

found in the parent cell.

4. Makes gametes (sex cells). In humans 4 sperm cells or 1 egg and three polar

bodies are produced each time meiosis occurs.

[pic]

[pic]

5. Separates pairs of homologous chromosomes so that offspring get one

chromosome of each pair from a different parent.

E. Fertilization occurs in the fallopian tube. A fertilized egg is called a zygote and has a

normal number of chromosomes (2n).

[pic]

F. The fetus develops in the uterus. Cells divide without becoming larger (cleavage). After a few days, cells begin to differentiate– that is they start to form different types of cells

(nerve, skin, bone, etc).

[pic]

At this stage the embryo is very vulnerable to alcohol, drugs, etc. because the important organs and systems are just starting to develop.

G. Human Reproduction

2. Female

[pic]

A. Oviduct B. Ovary

C. Uterus D. Vagina

Female – side view

[pic]

A. Ovary C. Uterus

B. Oviduct D. Urinary Bladder

3. Male

[pic]

A. Bladder C. Penis

B. Vas Deferens D. Testes

UNIT FIVE: Genetics:

A. Humans have 46 chromosomes, or 23 homologous pairs.

B. Chromosome pairs carry alleles for the same trait. We all have two alleles for each gene

- 1 from each parent, 1 on each member of the homologous pair.

C. While genes determine our traits, the environment can affect expression of genes.

[pic]

D. Each chromosome has hundreds or thousands of genes. Each gene codes for a particular

protein (1 gene=1 protein).

E. DNA is made of 4 bases: ATCG. A three letter codon represents a specific amino acid. These amino acids are assembled into proteins.

DNA Replication:

- DNA molecule untwists

- Two strands of DNA separate

- Molecular bases pair up

- Two identical DNA

F. Base pairs: A-T, C-G (in RNA, A-U and C-G)

[pic]

[pic]

G. RNA carries the genetic code to ribosomes. The ribosomes then synthesize protein (see page 2 for more about proteins).

[pic]

H. Changes to DNA are called mutations. They can only be passed on if they occur in

reproductive cells (sperm or egg).

I. All cells in the body contain the same genes. Only some of these genes are turned on (that is, your eye cells contain the instructions on how to make bones, but only the genes to make new eye cells are actually turned on).

J. Selective breeding produces animals and plants with desired traits (disease resistance, larger fruit, more meat or milk, specific colors).

K. Genetic engineering or gene splicing inserts genes of one organism into the genes of

another. Enzymes are used to cut and copy the DNA segments. Bacteria are often used because they have no nucleus protecting their DNA and they reproduce very quickly, allowing large amounts of medicine (insulin) to be made.

[pic]

a. The example of gene splicing you MUST know:

The gene to make human insulin was inserted into bacteria. These bacteria can

now make insulin that is exactly the same as human insulin. This insulin is used by

diabetics. This is safer than the cow and sheep insulin that were used in the past.

[pic]

L. New technologies (karyotyping, DNA fingerprinting) are making it easier to diagnose and treat genetic disease, though we cannot yet cure them.

M. Genetic research has posed many ethical problems (ie right and wrong) that science

alone cannot answer.

UNIT SIX: Evolution

A. Basically states that modern species evolved from earlier, different species and share a common ancestor.

[pic]

B. Charles Darwin proposed that natural selection is the mechanism that causes species to change. The basic steps in natural selection are:

1. Overproduction of offspring.

2. Competition for limited resources.

3. Survival & reproduction OR death.

C. Organisms that are better adapted to their environment and able to reproduce

successfully are considered “fit”. Unfit organisms die, and their traits are eventually

removed from the gene pool.

NOTE: Stronger is not always better.

D. Evolution is usually driven by a change in the environment.

E. To evolve, variations must exist in a species BEFORE the environment changes. They

do not get a trait just because it is needed.

F. Variations exist primarily as the result of sexual reproduction and mutation.

G. Species with more variation are better able to survive environmental changes.

H. Gradualism is a theory that says change occurs slowly. Punctuated equilibrium is a

theory that says evolution happens in quick spurts.

I. Creation of new species usually requires geographic isolation which eventually results in reproductive isolation.

J. Evidence in support of evolution comes from the fields of geology (fossil record and

radioactive dating), genetics, biochemistry, anatomy and embryology (among others).

[pic]

[pic]

UNIT SEVEN: Ecology:

A. Organisms interact with their environment (food webs, nutrient cycles).

[pic]

B. Energy is needed to keep an ecosystem going. The energy comes from the sun and is made usable by producers (plants and other autotrophs)

C. Energy is passed on to other organisms in the form of food. Since all organisms must use energy for their own needs, most energy is lost before it can be passé to the next step in the food chain.

[pic]

A. Decomposer

B. Secondary Consumer

C. Primary Consumer

D. Producer (Autotroph)

[pic]

As a result, organisms high on the food chain have less energy available to them and must have smaller populations.

D. Environmental factors (air, water, light, temperature, pH, food, predators etc) determine which organisms can live in an ecosystem and how large the population can get.

1. The maximum size of a population is called the carrying capacity.

E. There are many roles in an ecosystem (niche), but competition between species usually results in only one species occupying a niche at any one time. Often, organisms with similar needs will divide resources to reduce competition (ex: birds eat insects during the day, bats eat them at night).

F. The basic processes of ecological succession.

[pic]

Bare field (pioneer organisms - lichens) ( Grass Stage (

Shrub Stage ( Forest (Climax Community)

UNIT EIGHT: Human action

development, industrialization, pollution, farming, over hunting, overgrazing, clear cutting, introduction of foreign species, and soil erosion often has negative consequences for the ecosystem and humans.

A. The negative effects humans have had on the environment are all mostly due to the increasing human population.

B. Biodiversity refers to the variety of life on earth. As habitats are lost and species become extinct, biodiversity is reduced. This is bad because 1) ecosystems with low diversity take longer to recover from environmental changes and 2) we use organisms for many things such as food and medicine; by reducing biodiversity we are losing potentially valuable resources.

C. Human Actions to reduce or repair damage to the environment include:

1. Recycling wastes

2. Conserving available resources

3. Using cleaner resources (ex: solar over fossil fuels)

4. Protection of habitats and endangered species

5. Use of biological controls instead of pesticides and herbicides

6. Farming native plants (ex: cocoa in the rainforest)

7. Planting trees to replace those cut down.

8. Rotating crops or planting cover crops to reduce soil loss.

D. Know the following terms: producer – plants, algae, consumer – frog, grasshopper, omnivore – bear, humans, herbivore - deer, elephant carnivore - tiger, polar bear

predator – mountain lion parasite- tapeworm, leech habitat – place where an organism lives

niche – way of life / role, population- organisms of the same species

community- group of different species in an area

stable ecosystem requires materials to be recycled

ecosystem – interaction of living and nonliving things in an area ,

biosphere – life zone on earth,

pollution - release of environmental contaminants, renewable resource- Resources that can be replenished, such as trees and plants

limiting factor – abiotic factors determine type of organisms that can exist in the area

carrying capacity - max number of organisms the ecosystem can support

fossil fuels – oil, natural gas, and coal

symbiosis –close relationships

- commensalisms – (+, 0)

- mutualism – (+, + )

- parasitism – (+, - )

E. For the following ecological problems, you should be able to identify the specific cause, their negative effects on the environment, and a way the problem can be fixed.

1. acid rain

2. loss of habitat

3. loss of diversity

4. global warming

5. loss of ozone layer

6. introduced species

7. industrialization

8. landfills

PART D: LAB

MAKING CONNECTIONS

Students need to understand the following:

1. Controlled experiment

a. Determine the question.

b. Formulate a hypothesis / title

c. Design the experiment:

d. Sample size and number of trials to obtain valid conclusion.

2. Muscle fatigue is caused by both an oxygen deficiency and an accumulation of metabolites such as carbon dioxide and lactic acid which are not carried away in the blood stream as fast as they are produced.

3. Blood circulation should increase when a person is more active. This provides the cells with more food and oxygen.

4. A higher pulse rate (heart is beating at a higher rate) means that blood is moving rapidly throughout the body.

5. The circulatory system transports oxygen taken in by the respiratory system. When muscle cells increase their activity, they produce wastes at a higher rate. These waste are carried to the excretory system by the circulatory system more efficiently when heart rate increases.

6. Concept that individuals have different resting pulse rates and muscle performance.

7. Need for evidence before accepting claims made by others.

8. Prepare a histogram

DIFFUSION THROUGH A MEMBRANE

1. Understand the terms:

Diffusion / Osmosis (pg. 2).

When the molecules are even throughout a space - it is called Equilibrium.

Concentration gradient - a difference between

concentrations in a space.

Selectively Permeable (pg. 3) Glucose, iodine, and oxygen move freely across the cell's membrane, by diffusion.

Glucose Indicator Solution

Benedict's Solution (Blue-colored) turns brick red in presence of glucose (heated).

Starch Indicator Solution

Iodine – Lugol’s (Amber-colored) turns blue-black in the presence of starch.

**Salt on roads could damage or kill plants. Diffusion would cause the water inside the plant cells to leave the cells.

**Red blood cell in distilled water: swell and could lead to destruction of the blood cells.

Why are starches digested to glucose necessary ? Starch must be digested because its molecules are too large to diffuse across cell membranes. The starch would not be able to diffuse from the intestine into the blood and from the blood into the cells. Glucose is small and soluble, so it is able to diffuse.

Why the salty popcorn causes thirst ? Thirst is caused when

The salt may cause water to leave the cells of the mouth and throat due to diffusion.

Ex. Amoeba and Paramecium

Paramecium typically lives in a hypotonic environment which means that water diffuses from the outside to the inside of the animal by osmosis. Paramecium removes water by using active transport and has organelles called contractile vacuoles.

[pic]

[pic]

[pic]

[pic]

BEAKS OF FINCHES

1. Species evolve over time. Evolution is a result of the interactions between:

a. The potential for a species to increase its population

b. Genetic variation of offspring due to mutation and genetic recombination.

c. A limited amount of resources in the environment (ex. food, space, mates, etc.)

d. Selection by the environment of those individuals that are better able to survive and produce viable offspring (“survival of the fittest”)

2. Some characteristics / variations give individuals an advantage over others in surviving and reproducing. The offspring of these “better adapted” individuals will be more likely to survive and reproduce than those of other individuals. The proportion / frequency of individuals with favorable characteristics will increase.

3. Variation in a population increases the likelihood that at least some individuals will survive the changing environmental conditions.

Analysis

1. Those individuals with beaks best adapted for feeding on small seeds remained on the island at the end of Round One while those with “less adapted” beaks migrated to a new island.

2. Competition for food in Round Two should have had an adverse effect on feeding success.

3. There were fewer survivors at the end of Round Three due to increased competition.

4. The following four components of Natural Selection were simulated:

a. Variation: different beaks, different size seeds

b. Competition: more than one bird feeding at one bowl

c. Struggle for survival: each bird trying to get enough food to survive

d. Adaptation: particular characteristics of “beaks”

e. Environment: students, seeds, dishes are part of environment

f. Selecting agent: type of “beak” and / or type of seed available

[pic]

RELATIONSHIPS AND BIODIVERSITY

Key Points

1. The diversity of life on the planet has been created through the process of evolution by means of natural selection.

2. Through natural selection, organisms have evolved to lessen competition, and therefore fill a wide array of niches. This biodiversity increases the stability of ecosystems.

3. Biodiversity has important benefits to mankind, including development of new food sources and medicines; Ecosystem degradation and destruction lead to the loss of genetic biodiversity and increases the chance that an ecosystem will become less stable and collapse.

Procedures

1. Seven tests are conducted to determine the relatedness of Samples X,Y, and Z to Botana curus. They are as follows:

a. Structural Characteristics of Plants

b. Structural Characteristics of Seeds

c. Structural Characteristics of Stems (Internal Microscopic Structures)

d. Paper chromatography is a procedure used to separate substances in a mixture. This mixture is usually a solution of liquid plant pigments containing different kinds of chlorophyll and other colored photosynthetic pigments.  

[pic]

e. Indicator Test for Enzyme

f. Gel electrophoresis is a procedure used to separate charged molecules of different sizes by passing them through a gel in an electrical field. The gel is usually composed of a jelly-like material called agarose.

Molecules such as DNA fragments of different lengths and proteins of different sizes are often separated in the gel. The DNA fragments are then loaded into the wells in the gel.

To demonstrate techniques used in DNA analysis, a student was

given paper strip samples of DNA.

Sample ATTCCGGTAATCCCGTAATGCCGGATAATACTCCGGTAATATC

The student cut between the C and G in each of the shaded

CCGG sequences in sample.

*The action of what kind of molecules was being demonstrated when the DNA samples were cut?

DNA is cut into pieces for separation for electrophoresis by restriction enzymes (proteins, biological catalysts)

[pic]

Uses for the Gel Electrophoresis

1. May be used to determine an individual's genetic relationship to his or her ancestors, as the more closely matched the banding pattern between two individuals, the more closely they will be genetically related. In theory, no two individuals will form the same DNA banding pattern when the electrophoresis is completed.

 2. It may be used to identify an individual that have committed crimes based on the ability to match the suspects DNA.

 3. It may be used to determine evolutionary relationships between organisms, as organisms with a closer genetic relationship will form more similar banding patterns.

g. Make a Protein - Molecular Evidence for Relationships

1. Be able to write a complimentary messenger RNA base sequence that each of the DNA fragments given will produce.

2. Be able to use the universal genetic code to translate the messenger RNA base sequences into sequences of amino acids in the protein produced by each species .

3. State how the amino acid sequences obtained compare to the sequences of the other species.

LIVING ENVIRONMENT / BIOLOGY REVIEW

Unit 1: Science and the Living Environment

a. Scientific Method

b. Controlled Experiment

Unit 2: Characteristics of Living Things

a. Life Functions (Chemical Activities)

b. Organic Chemistry

c. Cells

Unit 3: Maintaining Homeostasis in the Human Body

a. Organization

b. Systems

c. Diseases and Disorders

Unit 4: Reproduction

a. Asexual / Sexual

b. Human Reproduction and Development

Unit 5: Genetics

a. Gene – Chromosomes

b. DNA

c. Protein Synthesis

d. Mutations

e. Genetic Engineering

Unit 6: Evolution

a. Natural Selection

b. Role of the Environment

c. Evidences

Unit 7: Ecology

a. Biotic and Abiotic Factors

b. Ecological Succession

Unit 8: Humans and the Biosphere

a. Negative Effects of Humans

b. Biodiversity

c. Positive Actions Taken by Humans

Part D: Lab

a. Making Connections

b. Diffusion Through a Membrane

c. Beaks of Finches

d. Relationships & Biodiversity

................
................

In order to avoid copyright disputes, this page is only a partial summary.

Google Online Preview   Download