The Lancet
Supplementary Fig. S1 Identification of differentially expressed circular RNAs in compression-treated human NP cells. Human NP cells were subjected to 1 MPa compression for 0 h, 12 h, 18 h, 24 h, 36 h, and the representative expression levels of ECM anabolism markers (aggrecan, collagen II), catabolism enzymes (MMP-3, MMP-13), and apoptosis-associated proteins (Bax, Bcl-2 and c-caspase 3) were measured by western blotting. p < 0.05 versus control, 0 h group served as a control, n=3. (b) The apoptosis rate of human NP cells under compression treatment for 0 h, 12 h, 18 h, 24 h and 36 h was detected by Annexin V-APC/7-AAD staining. *p < 0.05 versus control, 0 h group served as a control, n=3 [one-way analysis of variance]. Data presented as means with error bars representing standard deviation (SD). (c-d) The top 30 predicted functions of the down-regulated or the up-regulated circRNAs host genes were obtained with gene ontology (GO) analysis, which were categorized based on biological process, cellular component and molecular function. (e-f) The top 30 enrichment pathways of the down-regulated or the up-regulated circRNAs host genes were obtained with KEGG analysis. The larger the rich factor, the greater the enrichment.Supplementary Table S1 Specimens informationNumberAgeGenderDisc levelPfirrmann gradeIS-120FemaleL1/L2IIIS-218FemaleL2/L3I IS-319MaleL2/L3IIS-422FemaleL2/L3IIIS-516FemaleL1/L2IIS-617MaleL2/L3IIS-726FemaleL2/L3IIIS-825MaleL3/L4IIIS-920MaleL3/L4IIIS-1031MaleL3/L4IIIS-1122FemaleL2/L3IIIS-1224MaleL1/L2IIIS-1313FemaleL2/L3IIS-1430FemaleL1/L2IIIS-1514FemaleL2/L3IIDD-165FemaleL3/L4VIDD-255MaleL5/S1VIDD-353FemaleL4/L5VIDD-461FemaleL3/L4VIDD-540MaleL3/L4IVIDD-671FemaleL4/L5VIDD-743FemaleL4/L5IVIDD-860MaleL3/L4VIDD-961MaleL4/L5VIDD-1049FemaleL4/L5IVIDD-1132MaleL4/L5IVIDD-1253MaleL5/S1VIDD-1362FemaleL4/L5VIDD-1436MaleL3/L4IVIDD-1562FemaleL3/L4VIDD-1639FemaleL4/L5IVIDD-1764FemaleL4/L5VIDD-1860MaleL3/L4VIDD-1957MaleL4/L5VIDD-2045MaleL3/L4IVIDD-2137MaleL4/L5IVIDD-2240FemaleL3/L4IVIDD-2366FemaleL4/L5VIDD-2448FemaleL4/L5IVIDD-2570MaleL3/L4VIDD-2654MaleL5/S1VIDD-2743FemaleL4/L5IVIDD-2847MaleL4/L5IVIDD-2976FemaleL3/L4VIDD-3065FemaleL4/L5VAnnotationIS: idiopathic scoliosis; IDD: intervertebral disc degenerative disease The IVD degeneration degrees were assessed by the Pfirrmann MRI-grading system: non-degenerated (grade I-II), mildly degenerated (grade III), moderately degenerated (grade IV), severely degenerated (grade V). (Pfirrmann et al. Magnetic resonance classification of lumbar intervertebral disc degeneration. Spine. 2001;26(17):1873-8.)Of all the specimens, specimens from Number IS-1, IS-2 and IS-3 were used to isolate human NP cells as control samples. The three control samples were first used in examining the effects of compression treatment (results in figure S1a&b). Then the human NP cells with compression treatment for 36 h were used as compression samples, and the three control vs. three compression samples were used to detect circRNAs using circRNA microarray assay. Specimens from Number IS-4, IS-5 and IS-6 were used to isolate NP cells for the further in vitro experiments. All the tissue specimens were used in determining the expression levels of circRNA-CIDN, miR-34a-5p and SIRT1, aggrecan and collagen II mRNA using qRT-PCR analysis.Supplementary Table S2 Primers used in this studyPrimers for qRT-PCRmiR-34a-5pFTGCGCTGGCAGTGTCTTAGCTLoop primerGTCGTATCCAGTGCAGGGTCCGAGGTATTCGCACTGGATACGACACAACCAGcircRNA-CIDNFCCACCAGAGCACCATAGACCRGGCACGACCCGCAGAASIRT1FGCTGGCCTAATAGAGTGGCAARCTCAGCGCCATGGAAAATGTRIM25FGTTCGCGACCTGTTGCGCCGRTGTGCCTCAGGGTGGCCTCCAGType II collagenFAGAACTGGTGGAGCAGCAAGARAGCAGGCGTAGGAAGGTCATAggrecanFTGAGCGGCAGCACTTTGACRTGAGTACAGGAGGCTTGAGGU-6FCGCTTCGGCAGCACATATACRAAATATGGAACGCTTCACGAGADPHFGTCTTCACCACCATGGAGAARTAAGCAGTTGGTGGTGCAGhsa_circ_0005751FGTCAGCAGGAACCCTCAGATRCCCAAGGCCTCAGTTTTCAChsa_circ_0008620FCGAAGCCATTACCAGTGAAGGRTCTTCCTCATTGCAGCTTGThsa_circ_0074082FTCCAGAAGAGGGTGCAGAAARCTGCAGCTCATCAAGTGGAAhsa_circ_0060789FGCATTCCCTCCTTCCAGTRGACAATCCTCGGCTCCAChsa_circ_0060788FTCCCTCCTTCCAGTGTTCRCTGGTAATTCAGACGGACAhsa_circ_0060787FATCCTTCATCCCAACACTCRGCAATTTCAGGGCACATAhsa_circ_0026542FCTTGGGGTCATCGTTTCTGCRCACAGCTTGTCCAGGGGThsa_circ_0034408FGACCACGATGATGCAACCTCRCGGTGGCAGAAGTTATCGChsa_circ_0081466FGCTAGGACTCCAGTACCGTGRCTCCCCAATCTCTTCACCCCPrimers for PCRDivergent-GAPDHFCACTTTGTCAAGCTCATTTCCRTTGGCAGTGGGGACACGGAAGConvergent-GAPDHFTCCATGCCATCACTGCCACRGTGGTCGTTGAGGGCAATGDivergent-circRNA-CIDNFGAAGAGTGAGATCCAGACCTTGARACGACCCGCAGAAGTTGTGConvergent-circRNA-CIDNFAGTCCAGGGCTCGCCATACRAGATGCACTCGCTGTGCTC ................
................
In order to avoid copyright disputes, this page is only a partial summary.
To fulfill the demand for quickly locating and searching documents.
It is intelligent file search solution for home and business.
Related searches
- happiness is the meaning and the purpose of life the whole aim and end of human
- list the equipment required to measure the following and name the type of sampli
- the euro in decline how the currency could spoil the global financial system
- activity 1 1 match the word from the first column with the correct definition
- the english supremacy act of 1534 declared the to be the supreme head of th
- on the way to lunch the students stopped at the bathroom
- next experiment with the values in the calculator to complete the chart use up
- the penguins like to swim in the ocean and the seals do too
- the reflection of the moon danced across the ocean wave
- the sound of the sand blowing on the beach was soothing
- complete the table by writing the name of the cell organelle beside its structur
- the first four terms of a fibonacci sequence are a 2a 3a the sum of the f