1. AACGTACGATCGATGCACATGCATGGCTACGC ...
Name ____________________________________________pd.____________ Date ______________
DNA Base Pairing Worksheet
When a cell copies a DNA molecule:
1. DNA is unzipped.
2. The complementary bases are added to each template strand.
3. The 2 new strands are proofread for errors.
When a cell copies its DNA (replication), the original DNA ladder is broken apart and new nucleotides are
added to the center. This creates two exact copies, each one made from half the original DNA molecule.
?
?
?
DNA polymerase (the enzyme which builds DNA) will only attach bases which match with the
original strand of DNA.
In DNA replication, Adenine and Thymine will bong together and Cytosine and Guanine will
bond together.
When creating the matching stand the following pair ing rules must be used:
A? T
C? G
Directions: Use the base pairing rules above to figure out the sequence of the new strand of DNA for the
original strands below.
1. AACGTACGATCGATGCACATGCATGGCTACGC
2. CCCGGGTATGCATGTACGTACGTCGTATATCG
3. CGCGATCGAGCGATCGACGAATGCCTAGTTTT
4. TTAAACGAGCTGCTAGCTATTTTTAAAACCCCG
5. CCGCTTTCGCTATTATAAAAAGGGCTATAACTA
................
................
In order to avoid copyright disputes, this page is only a partial summary.
To fulfill the demand for quickly locating and searching documents.
It is intelligent file search solution for home and business.
Related download
- dna s secret code pennsylvania state university
- dna dna replication and mitosis practice test
- honors biology ninth grade pendleton high school
- dna base pairing worksheet sheffield
- 12 3 dna replication weebly
- questions with answers nucleotides nucleic acids
- dna double helix key chandler unified school district
- dna replication
- extra practice of chargaff s rule and complimentary base
- dna review worksheet denton isd
Related searches
- 1 or 2 374 374 1 0 0 0 1 168 1 1 default username and password
- 1 or 3 374 374 1 0 0 0 1 168 1 1 default username and password
- 1 or 2 711 711 1 0 0 0 1 168 1 1 default username and password
- 1 or 3 711 711 1 0 0 0 1 168 1 1 default username and password
- 1 or 2 693 693 1 0 0 0 1 168 1 1 default username and password
- 1 or 3 693 693 1 0 0 0 1 168 1 1 default username and password
- 1 or 2 593 593 1 0 0 0 1 or 2dvchrbu 168 1 1 default username and password
- 1 or 3 593 593 1 0 0 0 1 or 2dvchrbu 168 1 1 default username and password
- 1 or 2 910 910 1 0 0 0 1 168 1 1 default username and password
- 1 or 3 910 910 1 0 0 0 1 168 1 1 default username and password
- 192 1 or 2 33 33 1 0 0 0 1 1 1 default username and password
- 1 or 2 364 364 1 0 0 0 1 168 1 1 admin username and password