Addgene
Primer with index: CAAGCAGAAGACGGCATACGAGATCnnnnnnTTTCTTGGGTAGTTTGCAGTTTTnnnnnn denotes a user-specified sample barcode sequenceForward primer:AATGATACGGCGACCACCGAGATCTACACCCCACTGACGGGCACCGGAUsing ExTaq from Takara:Library: up to 2.5ugBuffer: 5uLdNTP: 4uLprimers mix (10uM): 1uLenzyme: 0.25uLH2O to 50uLAmplify reactions in a thermocycler using the following program.1 cycle94°C2 minutes30 cycles94°C20 seconds63°C30 seconds72°C45 seconds1 cycle72°C1 minute11 cycle4°CHOLDPCR purifySend to NextSeq75SR (asking for only 20 cycles) with index: nnnnnnIllumina primer 1 (with index): TTTCAAGTTACGGTAAGCATATGATAGTCCATTTTAAAACATAATTTTAAAACTGCAAACTACCCAAGAAAIllumina primer 2 (to sequence):TTTTCAAGTTGATAACGGACTAGCCTTATTTAAACTTGCTATGCTGTTTCCAGCATAGCTCTTAAAC ................
................
In order to avoid copyright disputes, this page is only a partial summary.
To fulfill the demand for quickly locating and searching documents.
It is intelligent file search solution for home and business.
Related download
- ifcap v 5 1 security guide home
- ehr request for proposal
- leverage azure multi factor authentication with azure ad
- audionote grand valley state university
- user guide for access to the electronic folder
- complete aspects of the template office of the national
- retail technologies for microsoft retail management
- rfp copier equipment and services