Ars.els-cdn.com
Supporting InformationBenzotriazole ultraviolet stabilizers show unique effects on the thyroid hormone receptor pathway in zebrafish (Danio rerio) embryosXuefang Liang, Jiajia Li, Christopher J. Martyniuk, Juan Wang, Yufeng Mao, Huan Lu, Jinmiao ZhaPages: 6Tables: 2Figures: 1This supporting information provides tables addressing (1) Primers for Quantitative Real-Time PCR Analysis (hypothalamus–pituitary–thyroid axis); (2) Fold-change of gene expressions in HPT axis in zebrafish embryos after 96-h exposure of BUVs.Figures provided in this supporting information addressing (1) BUVSs-dependent developmental toxicity endpoints in zebrafish.Table S1. Primers for Quantitative Real-Time PCR Analysis (hypothalamus–pituitary–thyroid axis)Gene nameSequence (5’→3’)Accession no.Housekeeping genes?-actin1F: TCTGGCATCACACCTTCTACAATAF057040.1R: TGTTGGCTTTGGGATTCAGG18s5F: tcgctagttggcatcgtttatgBX296557R: cggaggttcgaagacgatcaef1α1F: GAGGAAATCACCAAGGAAGTCABC064291.1R: AATCTTCCATCCCTTGAACCAGrpl83F: ttgttggtgttgttgctggtNM_200713R: ggatgctcaacaggggttcatrpl13a4F: AGCTCAAGATGGCAACACAGNM_212784R: AAGTTCTTCTCGTCCTCCHPT axis genescrh5F:ttcgggaagtaaccacaagcNM_001007379R:ctgcactctattcgccttccthraa2F: caatgtaccatttcgcgttgNM_131396R: gctcctgctctgtgttttcctrh1F: TGGAGCCGGAGGTGAAGANM_001012365.2R: GCAGTGGGGTCCTCTAGCATtshb3F: gcagatcctcacttcacctaccAY135147R: gcacaggtttggagcatctcatshr3F: gctccttgatgtgtccgaatNM_001145763R: cgggcagtcaggttacaaatslc5a51F: TGGTTGGTGTGGTGGTCAGTTANM_001089391.1R: GCATCGCAGGGCTTTTGTTtg1F: GCAGAGCCAAGAACATCAAGAATDQ278875.1R: GGCGAGTGCTGTAAAGAGTAGAACdio11F: GGTGGTGGATGAGATGAACAACNM_001007283.1R: TCCGATGCCTCCCTGATAGAdio21F: ATTTCTCCTTGCCTCCTCAGTGNM_212789.3R: GCCACCTCCGAACATCTTTAAGthrb1F: AGCGTTGTCAGGAGGAGTTTCNM_131340.1R: GATTGGATTGCCATCAGTCTTCtrhr3F: ctggtggtggtcaactccttNM_001114688R: gctttccaccgttgatgttttpo5F: gcgcttggaacacagtatcaEU267076R: cttcagcaccaaacccaaatnkx2.15F: aggacggtaaaccgtgtcagNM_131589R: caccatgctgctcgtgtactugt1ab5F: ccaccaagtctttccgtgttNM_213422R: gcagtccttcacaggctttcttr5F: cgggtggagtttgacactttBC081488R: gctcagaaggagagccagta1 Liang YQ, et al. / Comparative Biochemistry and Physiology, Part C 167 (2015) 101–1072 Liu C, et al. / Aquatic Toxicology 128– 129 (2013) 147– 1573 Liu C. et al. / Chemosphere 93 (2013) 2327–23324 Zucchi S, et al. / Toxicology and Applied Pharmacology 250 (2011) 137–1465 Tu W, et al. / Science of the Total Environment 542 (2016) 876–885Abbreviations:crh, corticotropin releasing hormonedio1 and dio2, iodothyronine deiodinasesef1α, elongation factor 1-alpha nkx2.1 (also known as TTF1), thyroid transcription factor-1; rpl8, ribosomal protein l8 rpl13a, ribosomal protein L13a slc5a5, solute carrier family 5 (sodium/iodide cotransporter), member 5tg, thyroglobulin thraa, thyroid hormone receptor alpha a thrb, thyroid hormone receptor beta tpo, thyroid peroxidase trh, thyrotropin-releasing hormone trhr, thyrotropin-releasing hormone receptor tshb, thyroid stimulating hormone β tshr, thyroid stimulating hormone receptorttr, transthyretinugt1ab, uridine diphosphate glucuronosyltransferase18s, 18s ribosomal RNAReferencesLiang YQ, Huang GY, Ying GG, Liu SS, Jiang YX, Liu S. Progesterone and norgestrel alter transcriptional expression of genes along the hypothalamic-pituitary-thyroid axis in zebrafish embryos-larvae. Comp Biochem Physiol C Toxicol Pharmacol 2015;167:101-107.Liu C, Wang Q, Liang K, Liu J, Zhou B, Zhang X, Liu H, Giesy JP, Yu H. Effects of tris(1,3-dichloro-2-propyl) phosphate and triphenyl phosphate on receptor-associated mRNA expression in zebrafish embryos/larvae. Aquat Toxicol. 2013;128-129:147-157. Liu C, Yu H, Zhang X. Zebrafish embryos/larvae for rapid determination of effects on hypothalamic-pituitary-thyroid (HPT) and hypothalamic-pituitary-interrenal (HPI) axis: mRNA expression .Chemosphere. 2013;93:2327-2332.Zucchi S, Blüthgen N, Ieronimo A, Fent K. The UV-absorber benzophenone-4 alters transcripts of genes involved in hormonal pathways in zebrafish (Danio rerio) eleuthero-embryos and adult males. Toxicol Appl Pharmacol, 2011, 250: 137-146.Tu W, Xu C, Lu B, Lin C, Wu Y, Liu W. Acute exposure to synthetic pyrethroids causes bioconcentration and disruption of the hypothalamus–pituitary–thyroid axis in zebrafish embryos. Sci Total Environ 2016; 542, 876-885.Table S2. Fold-change for transcripts in the HPT axis in zebrafish embryos after 96-h exposure of BUVSs. UV-329UV-234UV-PUV-326GeneCon.(?g/L)MeanaSEMMeanSEMMeanSEMMeanSEMcrh010.1310.1910.2410.3011.270.140.670.031.140.173.480.98102.070.211.290.100.700.124.240.941002.820.263.400.321.050.123.660.27dio1010.1010.2210.1310.2411.320.052.660.461.980.262.410.55101.200.092.120.201.350.233.220.481002.110.282.100.681.640.301.620.25dio2010.1810.2710.1210.3010.480.041.030.171.150.113.200.48100.960.111.950.130.800.334.350.641001.600.292.060.250.920.172.420.29tg010.0610.1610.2510.3310.750.050.890.181.580.154.961.17100.800.091.720.210.830.184.150.701002.100.252.840.450.800.172.900.39thraa010.1410.2410.0910.2910.920.040.530.071.180.183.630.31100.770.111.290.170.770.143.740.311002.160.291.170.150.970.181.880.24thrb010.1210.2110.0910.3010.860.080.710.081.340.311.500.38100.950.112.200.110.480.092.700.351002.450.322.390.240.680.251.070.26trhr010.0610.1910.1310.1710.480.021.100.271.620.124.600.31100.450.030.670.150.310.024.390.551000.390.060.730.190.730.151.010.14nkx2.1010.0810.2210.1910.2712.720.380.830.264.121.011.600.34104.190.252.020.367.422.211.910.321003.860.581.500.417.522.172.090.58tpo010.2910.1510.3210.0911.610.360.780.061.670.322.070.26101.280.212.110.461.620.582.080.291001.100.220.720.042.910.821.350.17trh010.2110.1710.2010.3211.090.270.990.122.680.332.050.51101.670.192.250.372.480.421.850.451001.400.223.960.432.330.311.730.50tshb010.1110.2510.2010.2911.100.180.450.040.970.270.970.19101.560.370.960.041.520.350.660.151001.990.140.890.141.350.490.530.15tshr010.1710.1310.1610.1713.700.261.100.272.440.532.230.15100.860.061.180.162.960.231.270.181002.450.251.290.346.301.993.230.46ttr010.0610.2310.1910.2811.630.070.930.320.800.231.270.23102.650.320.770.180.800.170.630.081002.750.251.530.290.630.220.330.03ugt010.1410.1210.1910.3111.820.310.820.192.600.251.080.16102.490.141.760.142.140.350.940.231002.930.311.1200.212.600.361.220.30slc5a5010.0610.1010.1610.2010.880.110.440.050.920.101.120.14101.200.120.220.010.680.241.680.081001.010.120.430.040.910.291.510.13a p<0.05, ratio>2 indicates significant difference between each exposure group and the control. Red indicates up-regulation and blue indicates down-regulation.Fig. S1Fig. S1 BUVSs-dependent developmental toxicity endpoints in zebrafish. Embryos were exposed to either water or the BUVs, and data were recorded between 24 and 96 hpf. a) control, b) 72hpf embryos exposed to 10?g/L UV-234, c) 72hpf embryos exposed to 10?g/L UV-329. LP, low pigment; SL, spinal lordosis ................
................
In order to avoid copyright disputes, this page is only a partial summary.
To fulfill the demand for quickly locating and searching documents.
It is intelligent file search solution for home and business.