Name



Name __________________________ Pd _____ Date ______________________

Foundations of Biology Mr. Thompson

Protein Synthesis Webquest



Are you ready to transcribe a DNA sequence and translate into a protein?

The DNA that makes up the human genome can be subdivided into information bytes called ______________. Each gene encodes a unique ____________ that performs a specialized function in the cell. The human genome contains more than __________________ genes.

Cells use the two-step process of ___________________ and ______________________ to read each gene and produce the string of amino acids that makes up a protein. The basic rules for translating a gene into a protein are laid out in the ________________________________.

Basic Steps of Protein Synthesis

1. DNA molecule is unzipped by special enzymes that allow ___________ to be made from the DNA template.

2. The process of creating RNA from DNA is called ________________________.

3. Using the small DNA sequence (gene) below, transcribe (rewrite the code) for a RNA molecule

DNA Strand: ATTACGATCTGCACAAGATCCT

RNA Strand: ______________________________ Hint: Uracil replaces Thymine in RNA!

4. The mRNA strand produced will deliver the __________________ or recipe needed to make a specific protein.

5. Information is stored on the RNA molecule in a triplet code called a ________________.

6. Codons are a sequence of __________ nitrogen bases that code for a specific amino acid.

7. The mRNA strand will leave the nucleus and attach itself to a __________________, the site of protein synthesis.

8. When attached to a ribosome, the process of ____________________ will occur which is the process of translating the mRNA codons into specific proteins.

9. Translation always begins when tRNA bonds will the universal start codon __________.

10. ________________________ is always the first amino acid that begins the formation of proteins.

11. tRNA’s main job is to translate mRNA’s code and ________________/place the specific amino acid in the correct sequence based on the code.

12. After the AUG start codon is translated, the next three nucleotides (codon) are _____________ and another amino acid is added to the growing polypeptide.

13. Each sequence of three nucleotides corresponds with a ________________ amino acid.

14. Amino acids will continue to be added to the growing polypeptide (protein) until one the 3 _____________ codons are reached.

15. Continue Translating the mRNA strand produced in question #3, complete amino acid sequence below:

Methionine - _________-___________-___________- ____________-___________ - STOP

16. Codons are found on mRNA and anitcodons are found on ____________.

EX. If the mRNA codon is AUG, then the tRNA anticodon would be

UAC

17. What would the anticodon be for AUG?

18. What would the anticodon be for UUU?

19. What would the anticodon be for AAG?

20. What would the anticodon be for CCG?

If time is available, try transcribing and translating the virtual gene again!!!

................
................

In order to avoid copyright disputes, this page is only a partial summary.

Google Online Preview   Download