DNA Discovery, Structure, Replication, Transcription ...
Name________________________________________________per____Date___________________
DNA Structure, Replication, Transcription, Translation and Mutation Unit Review
The test will be on Friday 4/17/09. This review is due at the time of the test.
1. Identify the contribution of each of the following scientists to the discovery of DNA.
a. Mendel b. Meischer
c. Levene d. Avery
e. Hershey & Chase f. Chargaff
g. Wilkins and Franklin h. Watson and Crick
2. Draw a nucleotide of DNA and identify the three parts
3. Identify the 4 nitrogen bases found in DNA
a. b. c. d.
4. Use the base pairing rules to correctly match the nitrogen bases together.
________________pairs with_______________ ________________pairs with ______________
[pic]
14. For each process below, identify where it occurs in the cell, what is produced and why the process is necessary
Replication:
Transcription:
Translation:
15. What is the Central Dogma of Molecular Biology?
16. The process of replication is described as semi-conservative. What does this mean?
17. Describe the role of complementary base pairing in DNA Replication
18.Explain the replication of DNA. Include the role of helicase, DNA polymerase, replication bubbles, the replication fork, leading strand and lagging strand.
19. What is the benefit of having multiple replication bubbles?
Use the diagram below to answer questions 20-24.
[pic]
20. Identify the leading strand.
21. Identify the lagging strand.
22. Identify parent strands
23. Identify the new strands created by replication.
24. Which enzyme is identified at C?
25. List three differences between DNA and RNA
a.
b.
c.
26. Identify 3 types of RNA, where they are found and what they do.
a.
b.
c.
27. What is produced by transcription?
28. Explain how DNA and mRNA relates to a protein.
29. Explain why transcription is necessary.
30. What is the relationship between amino acids, protein shape and protein function?
31. What is the relationship between codons and amino acids?
32. Explain the transcription of DNA. Include the role of DNA, the promoter, RNA polymerase, terminator, mRNA
33. Explain what introns and exons are.
Use the diagrams below to answer questions 34 - 45
[pic]
34. What process is represented by diagram 1?
35. What process is represented by diagram 2?
36. What is labeled at A?
37. What is labeled at B?
38. What is labeled at C?
39. What is labeled at D?
40. What is labeled at E?
41. What is labeled at F, G and H?
42. What is labeled at I?
43. What is labeled at J?
44. What is labeled at K?
45. What is labeled at L?
46. Explain what happens in translation. Include the role of mRNA, the ribosome, A & P sites, tRNA, amino acids, the start codon, mRNA codons, tRNA anti-codons
47. Define triplet, codon and anti-codon
triplet:
codon:
anti-codon:
48. Use your codon chart on to complete the table below.
|DNA Triplet | | | TTC | |
|mRNA codon | | | | UAG |
|tRNA anti-codon | | CAG | | |
|Amino acid coded | met | | | |
49. Using the following DNA sequences, identify each of the following: Point mutation and frameshift mutations : insertion and deletion
TACGCCAGCCCGAGCTATAAAATT
Mutation 1: TACGCAGCCCGAGCTATAAAATT
Mutation 2: TACGCCAGCCCGAACTATAAAATT
Mutation 3: TACGCCATGCCCGAGCTATAAAATT
50. Which mutations above would have the have the greatest impact on an organism? Why?
................
................
In order to avoid copyright disputes, this page is only a partial summary.
To fulfill the demand for quickly locating and searching documents.
It is intelligent file search solution for home and business.
Related searches
- dna replication transcription and translation
- dna replication steps khan academy
- dna replication vs transcription translation
- khan academy dna replication video
- compare dna replication and transcription
- dna replication transcription translation worksheet
- replication transcription and translation key
- dna structure and replication worksheet answer key
- dna replication khan
- dna replication khan academy
- dna structure and replication pogil
- dna structure and replication answer key