A1.1.2.StudentResource



Activity 1.1.2 Student Resource Sheet Outbreak Investigation Day 1The university infirmary is flooded with students seeking medical treatment. The following information was collected from each student upon examination. SueAn 18 year-old biology major who plays on the college soccer team, Sue reports a headache that never seems to go away and extreme lethargy. She admits that she has not been getting much sleep lately. Between soccer games and studying for tests, she has been living on energy drinks and coffee. She has been known to pull “all-nighters” to get her work done. She spent last weekend visiting a friend at another university. This certainly did not help her catch up on her sleep. When she arrives, her temperature is 100.6°F. JillJill, Sue’s roommate and teammate on the soccer team, feels extremely run down. She played the entire game the last two afternoons and her whole body feels tight. She has been trying to stretch and has even completed a session with the trainer at the athletic center, but she still feels sore. She makes sure to drink water before, during, and after all practices and games, and she stays away from highly caffeinated beverages. Jill is also running a slight fever, 99.7°F, but she says her body temperature is always a bit high. Even though she is trying to quit, Jill reports smoking an occasional cigarette when she is out at parties. AnthonyAnthony has a dry cough that just will not go away. He has been more tired than normal, his muscles ache, and his sinuses have really been bothering him. His temperature has remained at about 100°F the past few days. His friend Maria gave him some over-the-counter cold medicine, and while it seems to have relieved some of the pressure on his sinuses, he still does not feel well. Anthony is a reporter for the school paper. He spends a good deal of time running back and forth across campus trying to cover multiple games at one time. He has probably found every shortcut through the woods on campus. WandaWanda has had a fever for the past few days and she just noticed that the glands in her neck are swollen. This morning, she woke up to a sore throat so she decided to get herself checked out by a doctor. Her boyfriend, Ray, also has the same symptoms, but he hates doctors and says he will just take Tylenol and ride it out. Wanda has not seen Ray as much as she would like lately. She is pledging the same sorority as Jill. They have had long meetings every night for the past two weeks and have attended many concerts and parties on campus. MaggieMaggie’s throat has been scratchy the past few days. She has been keeping an eye on it as she is a singer in a popular campus band. She has been drinking tea and gargling with salt water, but this morning she woke up feeling like her throat was on fire. Her head feels heavy and she can not seem to regulate her temperature. One minute she is hot and the next she is cold. Maggie lives on the same floor as Sue and Jill. They see each other at dorm functions all the time and have chemistry class together, but they each have their own circle of friends. Maria Maria has been feeling run down for the past few days. She hates doctors so she has put this off as long as possible. But this morning, she could barely get out of bed and her forehead feels like it is on fire. When she arrives at the infirmary, her fever is almost 103°F. Maria lives down the hall from Jill and Sue. Others in the dorm joke that Maria should just move in; she is always over at their room and she is constantly eating their food. Jill says she can not even put down her glass for a second because Maria will drink from it. Arnie Arnie has been coughing and dealing with a runny nose all week. He has made sure to put on his jacket, hat and gloves when he goes outside, and to increase his vitamins, but he just seems to get worse. Last night, he could not stop coughing when he was talking to his girlfriend on the phone. He did not think he had a fever, but when he arrives at the infirmary, he learns that his temperature is 100.5°F. Arnie is studying photography and loves to take black and white shots of athletic competition. A few of his pictures have been featured in the school paper. Anthony, a guy who lives on his floor, has been helping him pick which shots to submit. Activity 1.1.3 Student Resource Sheet Outbreak Investigation Day 2The following day, more patients show up at the infirmary. A history and physical is completed for each new patient. The laboratory also returns additional data for patient Sue Smith. New patients:MarcoMarco complains of extreme fatigue and a killer headache. He feels like he is coming down with a cold. Marco is supposed to go home for the holidays and does not want to pass whatever he has to his girlfriend, Elena. He figures if he can get some medication now, he can take care of any bug before he feels truly miserable. Marco is Sue’s lab partner for biology. They did not know each other before being paired in the lab, but after spending four hours together two times a week, they have become good friends. Even though they are not supposed to eat in the lab, they alternate bringing in food and drink and share these snacks during their breaks. Alvin Alvin comes in to the infirmary complaining of a headache and a sore throat. He was at a concert last night and he thinks some of the soreness is due to his enthusiastic yelling, but he wants to at least get some medication for his headache. Alvin has been up all week studying for his chemistry test, but he does make some time for his music. He plays guitar and he has just started getting involved with some of the music groups on campus. As he is sitting in the waiting room, he spots Marco, his neighbor in the dorm. New evidence:SueSue is still feeling awful. She must have slept in the wrong position because her neck feels extremely tight when she wakes up. Sue is supposed to leave for a soccer trip two days from now and she really hopes that whatever she has will not keep her from participating. She comes back to the infirmary to find out the results of the tests that were run the previous day.Samples of Sue’s blood, urine, and lymph were collected at the first visit and were used for diagnostic laboratory tests. As part of a pilot study, the college infirmary is working with the molecular biology department at the college to identify pathogens by their DNA sequences. The lab has isolated primers, small segments of DNA that attach to key genes in bacteria and viruses and allow amplification and sequencing of the DNA. Sue’s samples were sent out for molecular testing. Little did you know what you would find!The lab returns the following sequence data from Sue’s sample:atgacccgtc aatctctgca acaggctgcc gaaagccgcc gttccattta ttcgttaaataaaaatctgc ccgtcggcaa agatgaaatc gtccaaatcg tcgaacacgc cgttttgcacacaccttctt cgttcaattc ccaatctgcc cgtgtggtcg tgctgtttgg cgaagagcatActivity 1.1.6 Student Resource Sheet Outbreak Investigation Day 3Additional patient information is collected at the infirmary. The general lab and the molecular lab return test results for the patients not infected with bacterial meningitis. AnthonyAnthony is becoming impatient and says he just needs an antibiotic and he will be fine. His throat culture samples have not revealed an infectious bacterium. The lab returned the following sequence data:cgcgtttatc ttgcccgggc tcaacctttc agaaagcact cctaattagc cctcatagat tcggagaaac caaaggaaac tcagctccct tgataataag ggaacctttt attgcttgtggaccaaatga atgcaaacac tttgctctaa cccattatgc agcccaacca gggggatactacaatggaac aagaggagac agaaacaagc tgaggcatct aatttcagtc aaattgggcaWandaWanda has become so tired that she can not even make it to class. Her roommate has been kind enough to take notes for her. Her glands are still extremely swollen. The lab returned the following sequence data:ttgtggcggc atcatgtttt tggcatgtgt acttgtcctt atcgtcgacg ctgttttgcagctgagtccc ctccttggag ctgtaactgt ggtttccatg acgctgctgc tactggctttcgtcctctgg ctctcttcgc cagggggcct aggtactctt ggtgcagccc ttttaacgttggcagcaggt aagccacacg tgtgacattg cttgcctttt tgccacatgt tttctggacacaggactaac catgccatct ctgattatag ctctggcact gctagcgtca ctgattttgggcacacttaa cttgactaca atgttccttc MaggieMaggie can hardly swallow and she certainly can not sing. She is still running a high fever. She has been drinking lots of juice and taking vitamin supplements, but sleeping seems to be her only relief. Bacteria cultures have revealed an infectious pathogen. The lab returned the following sequence data: atgaatatta gaaataagat tgaaaatagt aaaacactac tatttacatc ccttgtagccgtggctctac taggagctac acaaccagtt tcagccgaaa cgtatacatc acgcaattttgactggtctg gagatgactg gcctgaagat gactggtctg gagatggttt gtctaaatatArnieArnie had to walk out of photography class yesterday as he was coughing so much. He gets the chills easily and he sees his overall energy beginning to decline. The lab returned the following sequence data: agcagaagca gagcatcttc tcaaaactga ggcaaatagg ccaaaaatga acaatgctaccttcaactat acaaacgtta accctatttc tcacatcagg gggagtatta ttatcactatatgtgtcagc ttcattgtca tacttactat attcggatat attgctaaaa ttttcaccaacagaaataac tgcaccaaca atgccattgg attgtgcaaa cgcatcaaat gttcaggctgtgaaccgttc tgcaacaaaa ggggtgacac ttcttctccc agaaccggag tggacataccAlvinAlvin refused to have any samples taken and walked out of the office. You did, however, note that Wanda met him outside of the infirmary with a hot cup of coffee. ................
................

In order to avoid copyright disputes, this page is only a partial summary.

Google Online Preview   Download