GRDZELISHVILI LABORATORY - Overview



Grdzelishvili Laboratory

STUDENTS’ LAB MANUAL

|CHAPTERS |Protocol No. |

|CHAPTER 1: Instructions for Notebook Keeping. |Protocol 1-1 |

|CHAPTER 2: General Issues. | |

|General Laboratory Methods. |Protocol 2-1 |

|Chemical safety. |Protocol 2-2 |

|Radiation safety. | |

|CHAPTER 3: Vector NTI User's Guide. |Protocol 3-1 |

|CHAPTER 4: Molecular Cloning Methods. | |

|Primer design for PCR. |Protocol 4-1 |

|PCR amplification of DNA. |Protocol 4-2 |

|Restriction enzyme digestion of DNA. |Protocol 4-3 |

|Agarose gel electrophoresis. |Protocol 4-4 |

|Ethanol precipitation of DNA. |Protocol 4-5 |

|Preparative DNA Fragment Isolation from agarose gel. |Protocol 4-6 |

|Ligations of plasmid and insert DNAs. |Protocol 4-7 |

|Transformation of E. coli. |Protocol 4-8 |

|Preparation of competent E.coli cells. |Protocol 4-9 |

|Colony PCR. |Protocol 4-10 |

|MINIPREP Plasmid amplification and extraction from E.coli. |Protocol 4-11 |

|MIDIPREP or MAXIPREP Plasmid amplification and extraction from E.coli. |Protocol 4-12 |

|Measuring DNA concentration. |Protocol 4-13 |

|CHAPTER 5: Protein Analysis. | |

|Measuring protein concentration. |Protocol 5-1 |

|Total protein isolation for Western Blot analysis. |Protocol 5-2 |

|Western Blot analysis. |Protocol 5-3 |

|Protein expression in E.coli. |Protocol 5-4 |

|CHAPTER 6: RNA Analysis. | |

|Total RNA isolation from cells. |Protocol 6-1 |

|Measuring RNA concentration. |Protocol 6-2 |

|RT-PCR analysis of RNA. |Protocol 6-3 |

|Northern blot analysis of RNA. |Protocol 6-4 |

|Primer extension analysis of RNA. |Protocol 6-5 |

|RNA protection assay. |Protocol 6-6 |

|CHAPTER 7: Genomic DNA Analysis. | |

|Southern blotting. |Protocol 7-1 |

|CHAPTER 8: Tissue Culture Methods. | |

|Tissue culture maintenance |Protocol 8-1 |

|Preservation and storage. |Protocol 8-2 |

|Determining cell counts. |Protocol 8-3 |

|Transfection of mammalian cells using “Lipofectamine”. |Protocol 8-4 |

|Generating recombinant cell lines stably expressing a gene of interest. |Protocol 8-5 |

|CHAPTER 9: Virology Methods. | |

|Plaque assay. |Protocol 9-1 |

|Growing virus in cell culture. |Protocol 9-2 |

|Growing virus in eggs. |Protocol 9-3 |

|Virus purification. |Protocol 9-4 |

|In vitro assays using viral genes. |Protocol 9-5 |

|In vitro assays using virus particles. |Protocol 9-6 |

|Generating recombinant viruses – “virus rescue” methods. |Protocol 9-7 |

|CHAPTER 10: Yeast Methods. |Protocol 10 |

|CHAPTER 11: Common Stock Solutions. |Protocol 11 |

PROTOCOL 1-1:

Instructions for Notebook Keeping

1. A notebook should be kept for laboratory experiments only using binders. The notebook should be written in ink, and each page signed and dated. Try to keep your notebook with the idea that someone else must be able to read and understand what you have done. The notebook should always be up-to-date and can be collected at any time. Importantly, your notebook belongs to the laboratory and will be used in the future by other lab members.

2. INDEX: An index containing the title of each experiment and the page number should be included at the beginning of the notebook.

3. WHAT SHOULD BE INCLUDED IN THE NOTEBOOK? Essentially everything you do in the laboratory should be in your notebook. The notebook should be organized by experiment only and should not be organized as a daily log. Start each new experiment on a new page. The top of the page should contain the title of the experiment, the date, and the page number. The page number is important for indexing, referring to previous experiments, and for labeling materials used in a given experiment. If an experiment spans more than one page, note the page on which the experiment continues if it's not on the next page. Each experiment should include the following:

4. Title/Purpose: Every experiment should have a title and it should be descriptive. An example would be "Large-scale plasmid preparation of plasmid pBS-L for transfection into BHK cells". When starting a new project, it is a good idea to introduce the overall strategy prior to beginning the first experiment, which will forces you to think about what you are doing and why and sometimes things look differently when written down than they do in your head.

5. Background information: This section should include any information that is pertinent to the execution of the experiment or to the interpretation of the results. For example, if it is a repeat experiment, state what will be done differently to get the experiment to work. If it's a cloning experiment, include what the strategy is and how the recombinants will be screened. A simple drawing of the plasmid map can be helpful. Include anything that will be helpful in carrying out the experiment and deciphering the experiment at a later date. For the most part, notebooks are not written for today but for the future.

6. Materials: This section should include the key materials, i.e., solutions or equipment that will be needed. It is not necessary to include every piece of lab equipment required, i.e. vortexer, pipetman, etc, but you should include any specialized equipment and the manufacturer, i.e., a phosphoimager or real-time PCR instrument. Composition of all buffers should be included unless they are standard or are referenced. Pre-packaged kits should be identified as to the name of the kit and the vendor. Biological samples should be identified by strain number, tissue type, and/or genotype with the source of the material identified. Enzymes should be identified by name, vendor, and concentration. DNA samples should be identified as to 1: type of DNA, i.e., chromosomal, plasmid, etc, 2: purity (miniprep, gel purified, PCR product) 3: concentration, if known, and 4: source (include prior experiment number if the DNA was isolated in a previous experiment). Include all calculations made in preparing solutions. The sequence of all oligonucleotides must be included or referenced. Agarose gels should be identified by percentage and buffer used. If any of these materials were used in previous experiments, include only the reference to that earlier experiment, do not repeat the information again.

7. Procedure: Write down exactly what you are going to do before you do it and make sure you understand each step before you do it. 1. You should include everything you do including all volumes and amounts; many protocols are written for general use and must be adapted for a specific application. 2. Writing a procedure out helps you to remember and to understand what it is about. It will also help you to identify steps that may be unclear or that need special attention. 3. Some procedures can be several pages long and include more information than is necessary in a notebook. However, it is good laboratory practice to have a separate notebook containing methods that you use on a regular basis. If an experiment is a repeat of an earlier experiment, you do not have to write down each step but refer to the earlier experiment by page or experiment number. If you make any changes, note the changes and why. Flow charts are sometimes helpful for experiments that have many parts. Tables are also useful if an experiment includes a set of reactions with multiple variables. It is good practice to check off steps as they are completed or reagents as they are added to prevent you from losing you place or for forgetting to add something. All procedures should be referenced.

8. Results: This section should include all raw data, including gel photographs, printouts, colony counts, autoradiographs, etc. All lanes on gel photographs must be labeled and always identify the source and the amount of any standards. This section should also include your analyzed data, for example, transformation efficiencies, calculations of specific activities or enzyme activities.

9. Conclusions/Summary: This is one of the most important sections. You should summarize all of your results, even if they were stated elsewhere and state any conclusions you can make. If the experiment didn't work, what went wrong and what will you do the next time to try to trouble shoot?

PROTOCOL 2-2:

Chemical Safety

General

It is prudent to minimize all chemical exposures. Because few laboratory chemicals are without hazards, general precautions for handling all laboratory chemicals should be adopted, in addition to specific guidelines for particular types of chemicals. Skin contact with chemicals should be avoided as a cardinal rule. Avoid underestimation of risk. Even for substances of no known significant hazard, exposure should be minimized; for work with substances that present special hazards, special precautions should be taken. One should assume that any mixture will be more toxic than its most toxic components and that all substances of unknown toxicity are toxic. Care must be taken to avoid chemical incompatibilities when planning experiments and operations. Provide adequate ventilation. The best way to prevent exposure to airborne substances is to prevent their escape into the working atmosphere, by use of hoods and other ventilation devices. The general principles mentioned above, the following procedures and rules should be used for essentially all laboratory work with chemicals:

Avoidance of "routine" exposure

1. Develop and encourage safe habits.

2. Avoid unnecessary exposure to chemicals by any route.

3. Do not smell or taste chemicals.

4. Vent apparatus which may discharge toxic chemicals (vacuum pumps, distillation columns, etc.) into fume hoods.

5. Inspect gloves and test glove boxes before use.

6. Do not allow release of toxic substances in cold rooms and warm rooms, since these often have contained, recirculated atmospheres.

7. Use only those chemicals for which the available ventilation system is appropriate.

Equipment and glassware

1. Handle and store laboratory glassware with care to avoid damage; do not use damaged glassware.

2. Use extra care with Dewar flasks and other evacuated glass apparatus; shield or wrap them to contain chemicals and fragments should implosion occur.

3. Use equipment only for its designed purpose.

Personal habits

1. Wash areas of exposed skin well before leaving the laboratory.

2. Avoid practical jokes or other behavior that might confuse, startle or distract another worker.

3. Do not use mouth suction for pipeting or starting a siphon.

4. Be alert to unsafe conditions and see that they are corrected when detected.

5. Do not eat, drink, smoke, chew gum, or apply cosmetics in laboratories or areas where laboratory chemicals are present.

6. Avoid storage, handling, or consumption of food or beverages in storage areas, refrigerators, glassware or utensils which are also used for laboratory operations.

Personal and protective apparel

1. Long hair should be confined.

2. Lab workers should not wear loose fitting or dangling clothing.

3. Clothing should cover as much of the worker’s skin as possible.

4. Lab workers must wear shoes at all times in the laboratory; but not sandals, perforated shoes, or canvas sneakers.

5. Protective apparel (lab coats, aprons, shoe covers etc.) with the required degree of protection for substances being handled should be available for each lab worker and visitor as appropriate.

Personal protective equipment

1. Assure that all persons, including visitors, where chemicals are stored or handled, wear appropriate eye protection.

2. Wear appropriate gloves when the potential for contact with toxic materials exists; inspect the gloves before each use, wash them before removal, and replace them periodically (a table of resistance to chemicals of common glove materials is given in Appendix C).

3. Use appropriate respiratory equipment when air contaminant concentrations are not sufficiently reduced by engineering controls, inspecting the respirator before use.

4. Use any other protective and emergency apparel and equipment as appropriate.

5. If contact lenses are worn in the laboratory, inform supervisor so special precautions can be taken.

6. Remove laboratory coats immediately when they become significantly contaminated.

Planning

1. Seek information and advice about hazards.

2. Plan appropriate protective procedures.

3. Plan the positioning of equipment before beginning any new operation.

4. Identify locations of safety equipment such as eyewash/shower stations, spill control equipment, and first-aid supplies.

5. Provide for containment of toxic substances in the event of failure of a utility service (such as cooling water).

Use of hood

1. Use the hood for operations that might result in release of toxic chemical vapors or dust.

2. As a rule of thumb, use a hood or other local ventilation device when working with any appreciably volatile substance.

3. Keep hood sash closed at all times, except when adjustments within the hood are being made.

4. Keep materials stored in hoods to a minimum and do not allow them to block vents or airflow.

5. Do not raise the hood above the 100 fpm mark when working with hazardous chemicals inside the hood.

6. Leave the hood "on" when it is not in active use if toxic substances are stored in it or if it is uncertain whether adequate general laboratory ventilation will be maintained when it is "off."

Waste disposal

1. Assure that the plan for each laboratory operation includes plans for waste disposal.

2. Deposit chemical waste in appropriately labeled receptacles and follow all other waste disposal procedures of the Chemical Hygiene Plan as well as the University Hazardous Waste Contingency, Management and Minimization Plans (see Appendices M, N, O).

3. Do not discharge concentrated acids or bases; toxic, malodorous, or lachrymatory materials or any other substances to the sanitary sewer that might interfere with the biological activity of waste water treatment plants, create fire or explosion hazards, cause structural damage or obstruct flow. (General rule of thumb, no disposal of chemicals down the drain.)

Working alone

1. Avoid working alone in a building.

2. Do not work alone in a laboratory if the procedures being conducted are hazardous.

Working with Allergens and Embryotoxins

1. Wear suitable gloves to prevent hand contact with allergens (examples: diazomethane, isocyanates, bichromates or substances of unknown allergenic activity).

2. If you are a woman of childbearing age, handle embryotoxic substances (examples: organomercurials, lead compounds, formamide) only in a hood in which satisfactory performance has been confirmed, using appropriate protective apparel (especially gloves) to prevent skin contact.

3. Review each use of these materials with the research supervisor and review continuing uses annually or whenever a procedural change is made.

4. Store these substances, properly labeled, in an adequately ventilated area in an unbreakable secondary container.

5. Notify supervisors of all incidents of exposure or spills; consult a qualified physician when appropriate.

Working with Highly Hazardous Chemicals, Reactives and Toxics (including “Select Carcinogens”)

The goal of the Chemical Hygiene Plan and program is to minimize exposure to highly hazardous chemicals, toxics and reactives using all reasonable precautions. Conduct all transfers and work with these substances in a "controlled area" (i.e. a restricted access hood, glove box, or portion of a lab designated for their use; for which all people with access are aware of the substances being used and necessary precautions). Assure that the controlled area is conspicuously marked and that all containers of these substances are appropriately labeled with identity and warning labels.

Before starting:

1. Prepare a plan for use and disposal of these materials and obtain the approval of the laboratory principle investigator.

2. Be prepared for accidents and spills. Assure that contingency plans, equipment, and materials to minimize exposures of people and property in case of accident are available.

3. Assure that at least 2 people are present at all times if a compound in use is highly toxic or of unknown toxicity.

4. Always use a hood or other containment device for procedures that may result in the generation of aerosols or vapors containing the substance. For a negative pressure glove box, ventilation rate must be at least 2-volume changes/hour and pressure at least 0.5 inches of water. For a positive pressure glove box, thoroughly check for leaks before each use. When using any glove box, trap the exit gases or filter them through a HEPA filter or chemical scrubber before releasing them into the hood.

5. Cover work and storage surfaces with removable, absorbent, plastic backed paper.

6. Always avoid skin contact by use of gloves and long sleeves (and other protective apparel as appropriate).

7. Protect vacuum pumps against contamination by scrubbers or HEPA filters and vent them into the hood.

8. If use of toxicologically significant quantities of such a substance on a regular basis is anticipated, consult a qualified physician concerning desirability of regular medical surveillance.

While working:

1. Work and mount apparatus above chemically resistant trays.

2. If a major spill occurs outside the hood, evacuate the area and assure that cleanup personnel wear suitable protective apparel and equipment. Decontaminate the controlled area before normal work is resumed there. Use a wet mop or a vacuum cleaner equipped with a HEPA filter instead of dry sweeping if the toxic substance is a dry powder.

When the operation is complete:

1. Always wash hands and arms immediately after working with these materials.

2. Store containers of these chemicals only in a ventilated, limited access area in appropriately labeled, unbreakable, chemically resistant, secondary containers.

3. Thoroughly decontaminate contaminated clothing or shoes. Use chemical decontamination whenever possible; ensure that containers of contaminated waste (including washings from contaminated flasks) are transferred from the controlled area in a secondary container under the supervision of authorized personnel.

4. Store contaminated waste in closed, suitably labeled, impervious containers.

5. Decontaminate vacuum pumps or other contaminated equipment, including glassware, in the hood before removing them from the controlled area

Agency Emergency Telephone Numbers

UNC Charlotte Campus Police 911

Charlotte Police Emergency 9-911

Emergency Room, University Hospital 547-9251

Charlotte Fire Department 9-911 (City Dispatcher)

Medic 9-911

UNC Charlotte Safety Office (8:00 a.m. - 5:00 p.m.) Ext. 7-4291

Environmental Emergency 1-800-424-8802

(National Response Center)

Chemtrec (Info on Chemicals) 1-800-424-9300

Mecklenburg County Environmental Protection 336-5500

Department - Immediate Response

NC Division of Water Quality (919) 733-5291

(Oil Spill)

State Warning Point (Non-business hours) 1-800-662-7956

Perma Fix (404) 859-4441

(Hazardous Waste Contractor)

UNC Charlotte Primary Emergency Coordinator:

Charles W. Seigler (803) 324-3803 (Home)

(704) 687-4291 (Office)

Luke Pokrajac, University Industrial Hygienist: (704) 687-4291

(704)-514-9200 Pager

Home Telephone: (803) 980-4999

Cellular Telephone: (803) 322-1645

READ, UNDERSTAND and then SIGN:

Name: Name:

Date: Date:

Name: Name:

Date: Date:

Name: Name:

Date: Date:

PROTOCOL 4-1:

Primer design for PCR

A primer is a short synthetic oligonucleotide which is used in many molecular techniques from PCR to DNA sequencing. These primers are designed to have a sequence which is the reverse complement of a region of template or target DNA to which we wish the primer to anneal.   

|[pic] |

Analysis of primer sequences. When designing primers for PCR, sequencing or mutagenesis it is often necessary to make predictions about these primers, for example melting temperature (Tm) and propensity to form dimers with itself or other primers in the reaction.  The following program from Integrated DNA Technologies will perform these calculations on any primer sequence or pair:

1. OLIGO Analyzer (analyzes your primer):



2. Primer Quest (helps you to pick the best primers for your template sequence):



The programs will calculate both the Tm of the primers, as well as any undesireable pairings of primers.  When primers form hairpin loops or dimers less primer is available for the desired reaction. 

|[pic] |

|[pic] |

Some thoughts on designing primers: 

1.  Primers should be 15-38 bases in length (ideally around 20);  

2.  Base composition should be 50-60% (G+C);  

3.  Primers should end (3') in a G or C, or CG or GC: this prevents "breathing" of ends and increases efficiency of priming;  

4. Tm between 55-80oC are preferred;  

5.  3'-ends of primers should not be complementary (ie. base pair), as otherwise primer dimers will be synthesised preferentially to any other product;  

6.  Primer self-complementarity (ability to form 2o structures such as hairpins) should be avoided;  

7.  Runs of three or more Cs or Gs at the 3'-ends of primers may promote mispriming at G or C-rich sequences (because of stability of annealing), and should be avoided.  

Also keep in mind that most oligonucleotide synthesis reactions are only 98% efficient.  This means that each time a base is added, only 98% of the oligos will receive the base.  This is not often critical with shorter oligos, but as length increases, so does the probability that a primer will be missing a base.  This is very important in mutagenesis or cloning reactions.  Purification by HPLC or PAGE is recommended in some cases.   

|Oligonucleotide length |Percent with correct sequence |

|10 bases |(0.98)10 = 81.7% |

|20 bases |(0.98)20 = 66.7% |

|30 bases |(0.98)30 = 54.6% |

|40 bases |(0.98)40 = 44.6% |

 

Designing Degenerate Oligonucleotides.

A group of degenerate oligonucleotides contain related sequences with differences at specific locations.  These are used simultaneously in the hope that one of the sequences of the oligonucleotides will be perfectly complementary to a target DNA sequence.

One common use of degenerate oligonucleotides is when the amino acid sequence of a protein is known.  One can reverse translate this sequence to determine all of the possible nucleotide sequences that could encode that amino acid sequence.  A set of degenerate oligonucleotides would then be produced matching those DNA sequences.  The following link will take you to a program that will perform a reverse translation. 

For example, the amino acid sequence shown in purple below could be encoded by the following codons.

AspGluGlyPheLeuSerTyrCysTrpLeuProHisGln

GATGAAGGTTTTCTTTCTTATTGTTGGCTTCCTCATCAA

  C  G  C  CT CAGC  C  C   T C  C  C  G

        A     A  A           A  A 

        G     G  G           G  G  

One could then select the 14 base sequence (in blue) to generate a smaller set of degenerate oligonucleotides.  Each oligonucleotide in the set would have one base changed at a time (shown in purple below).  A total of 32 unique oligonucleotides would be generated.

TATTGTTGGCTTCC

TACTGTTGGCTTCC

TATTGCTGGCTTCC

TACTGCTGGCTTCC

etc.

When ordering degenerate oligonucleotides, you just let the company know that you want a mixture of nucleotides added at a specific position using the code below.  By adding the mixture, oligos will incorporate one of the bases, leading to a mixture of oligonucleotides. 

|Standard MixBase Definitions |

|[pic] |A, G |

|[pic] |C, T |

|[pic] |A, C |

|[pic] |G, T |

|[pic] |C, G |

|[pic] |A, T |

|[pic] |A, C, T |

|[pic] |C, G, T |

|[pic] |A, C, G |

|[pic] |A, G, T |

|[pic] |A, C, G, T |

Cloning PCR Products . For cloning purposes, you can add additional restriction site to your primer to facilitate cloning process:

Introduction of restriction sites (common approach)

• It is possible to introduce restriction site sequences into PCR products by having these sequences incorporated into the 5' end of the PCR primer(s).

[pic]

• The short restriction site sequence on the 5' end of the PCR primer will not hybridize, but as long as the 3' hybridizing region is long enough (i.e. its Tm is high enough; ~20 mer) the primer will specifically bind to the appropriate site.

• The PCR product will thus have an additional DNA squence at the 5' end which will contain the endonuclease restriction site.

• A similar or different restriction site sequence can be added via the other PCR primer.

• If the other primer has a different restriction sequence then the PCR fragment can be inserted in a directional dependent manner in a host plasmid.

The potential problems with this method include:

• There is no easy way to prevent internal sites containing similar restriction sequences from being cut when the end of the PCR product are cut

• Restriction sequences are inverse repeat sequences, thus the potential exists for primer dimer association and resultant non-productive annealing

•

Generation of half sites (very exotic approach…)

• This method is similar to the method of introducing restriction sites, described above.

• The primary difference is that instead of the primer containing the entire restriction site sequence (say the six nucleotides of a six cutter) it will contain only the last three (and the other PCR primer will contain the complementary sequence for the first three).

[pic]

The advantages of this method are:

• Typically internal restriction sites cleave with much greater efficiency (i.e. some sites if located at the ends of linear DNA never cut well at all)

• There is no need to gel purify linker fragments after digestion

• The DNA can be methylated (the half sites will not be). After concatenation the linkers will be cut but internal restriction sites will not

• A disadvantage is that the same restriction site is incorporated into both ends so the PCR fragment cannot be ligated into a host vector in an orientation dependent manner.

• Also, in this method 3' A overhang cannot be tolerated.

Blunt end ligation (common approach)

• Some thermostable DNA polymerases (for example, Taq polymerase, but not Vent!) add a single dA residue onto the 3' end of the PCR product.

• There are three choices to be made when attempting to subclone without the use of added restriction sites within the primers:

o Use a DNA polymerase which leaves the 3' strand blunt (e.g. Vent) and do a blunt end ligation (i.e. host vector was opened up with blunt cutting restriction endonuclease)

o "Fix" the 3' A overhang by chewing back with Pol I, dNTP's.

o Use the 3' A overhang to anneal and ligate to a "T" vector - a vector which has a single dT overhang on its 3' ends.

Adding promoters, ribosome binding sites, start codons, and stop codons (common approach)

• The ability to add unique sequences to the 5' ends of PCR primers allows for short control elements to be directly incorporated.

• These can include a start codon or stop codon (3 bases), a promoter (~30 nucleotide region) or a ribosome binding site (~8 bases).

[pic]

PCR Mutagenesis

Gene fusion

• This method is useful for joining overlapping regions of a large gene, or for the construction of chimeric genes.

[pic]

Creation of deletions within a gene

• A very similar methodology can be used within a single gene for the production of a mutant gene containing a specific deletion:

[pic]

• If the gene is contained within circular DNA (i.e. a plasmid) deletions can be constructed in a single PCR reaction with a single set of primers (this type of methodology is also known as "inverse" PCR).

[pic]

Generation of point mutation(s) - i.e. base substitution mutations

• The generation of base substitutions can proceed along a similar route as with the deletion mutations.

• However, in this case the primers are mutagenic - there will be a mismatch, or mismatches, between the primer and target sequences.

• The mutagenic oligo will have a lower than expected Tm due to this mismatch(es).

[pic]

Introduction of base substitutions via asymmetric PCR:

[pic]

Insertion mutagenesis

• Short insertions (~1-6 basepairs) can be incorporated directly into a PCR primer, either internally, or at the 5' end.

• If the template DNA is linear and the desired site of insertion is not at the end of the template, then the entire gene (plus insertion) can be produced using asymmetric PCR or overlapping PCR (i.e. shown above).

[pic]

• Large insertions can be accomplished by using a template (the desired insertion) for PCR with the primers having 5' sequences which are complementary to the region of insertion in the desired gene:

[pic]

"Random" mutagenesis with PCR

• The PCR protocol can be modified so as to introduce mutations at random positions in the target DNA.

• The principle behind the mutagenesis is misincorporation of bases at "random" positions.

• Misincorporation by Taq polymerase, for example, can be achieved by adding Mn2+ to the reaction buffer, and decreasing the concentration of one of the four dNTP's.

o At the sites in the template where the reduced base should be incorporated, there will be an increased probability of misincorporation.

o Thus, the choice of base with diminished concentration determines the sites in the template which will potentially be mutated.

o The misincorporated base is more or less random.

• The ideal Mn2+ concentration to add varies between 0.1 to 0.5 mM and is determined empirically. The relative concentrations of bases is 1 mM for each base, except the reduced base, which is typically present at a 1:5 or 1:10 ratio (i.e. 0.2 to 0.1 mM).

PROTOCOL 4-2:

PCR amplification of DNA

_______________________________________________________________________________________

Materials:

• sterile ddH2O (keep separate tubes only for PCR!)

• 10X commercial ThermoPol PCR buffer (NEB Cat.# B9004S) (with 20mM MgCl2)

• 12.5 mM dNTP Mix (dATP+dCTP+dGTP+dTTP, each 12.5mM)

• 25 pM/μl (picoMole/microliter) oligonucleotide primer 1 (“upstream primer”)

• 25 pM/μl oligonucleotide primer 2 (“downstream primer”)

• 2 unit/μl Vent Polymerase (NEB Cat.# M0254S) or Taq Polymerase

(use Vent unless Taq is specified).

• template DNA (0.1-1 ng plasmid DNA)

Protocol:

1) Combine the following for each reaction (on ice) in a 0.2ml PCR tube:

Total 100μl:

|10X ThermoPol buffer | 10μl |

|Primer 1 | 1μl |

|Primer 2 | 1μl |

|dNTP Mix | 1μl |

|template DNA | X μl |

|H2O |[86-X] μl |

|Vent Polymerase | 1μl |

In addition, prepare

a) One negative control reaction with no template DNA and an additional 1μl of sterile water

b) One positive control reaction with a template DNA that should work as a template for your PCR.

2) If you are planning to prepare similar reactions with different DNA templates or primer sets, make a “master mix” containing all common components. For example, if you are testing 7 different DNA plasmids using the same primer set, make the following mix for: 1) 7 reactions (excluding DNA templates); 2) 1 negative control reaction; 3) 1 positive control reaction; 4) some extra volume (total 100 μl):

Example of 10X “master mix” to test 7 plasmids (1μl each):

|10X ThermoPol buffer | 100μl |

|Primer 1 | 10μl |

|Primer 2 | 10μl |

|dNTP Mix | 10μl |

|H2O | 850μl |

|Vent Polymerase | 10μl |

Add 99μl to 9 empty PCR tubes, then add 1μl of DNA to tubes 1-7, and 1μl of H2O to tube #8 (negative control), and 1μl of “positive” plasmid DNA to tube #9 (negative control).

3) Run the following program in the Bio-Rad PTC-100 thermal cycler (this particular “universal” program is called: “VALERY-U”):

1. 95°C 3 min (to completely denaturate DNA)

2. 95°C 30 sec

3. 55°C 45 sec or annealing temperature appropriate for particular primer pair

4. 72°C 1 min (if product is ................
................

In order to avoid copyright disputes, this page is only a partial summary.

Google Online Preview   Download