Introduction - University of Florida



PLANT MITOCHONDRIAL INTRONS AS GENETIC MARKERS

BY

MELINDA GROSSER

A THESIS PRESENTED TO THE BIOLOGY DEPARTMENT IN THE COLLEGE OF

LIBERAL ARTS AND SCIENCE OF THE UNIVERSITY OF FLORIDA IN PARTIAL

FULFILLMENT OF THE REQUIREMENTS FOR GRADUATION WITH HONORS

UNIVERSITY OF FLORIDA

2011

Introduction

Plant mitochondrial genetic markers that show polymorphism in closely related species groups could be useful in a wide variety of plant genetic studies (e.g. fingerprinting and genetic diversity studies). For example, mitochondrial markers have been used in rice to detect impurities in cytoplasmically male sterile seed stocks used as parental lines to create hybrids, which is important for optimizing yield in hybrid plants (Rajendrakumar et al. 2007). Polymorphic mitochondrial repeats have been used as markers in spruce to show population differentiation and geographic distribution (Sperisen et al. 2001). Expanding the number of available mitochondrial markers would make applications like these possible in a greater variety of species.

Citrus cybrids

Another application, and our original motivation for identifying mitochondrial markers, was to verify organelle inheritance of citrus cybrids. A cybrid is a byproduct of somatic cell fusion in which the resultant product is a diploid containing the nuclear genome from the leaf cell fusion partner, and the mitochondrial genome of the cell culture fusion partner (Saito et al. 1993, reviewed in Guo et al 2004a). This is important because cybridization could be a way to transfer mitochondrial genes that may be involved in canker resistance or cytoplasmic male sterility (CMS) to other species without otherwise altering the nuclear genome and desirable phenotypes of that species. For example, seedlessness in Satsuma (Citrus unshui) due to CMS is difficult to pass on to other cultivars through conventional breeding, so cybridization may make it much more possible to pass on the trait to other commercial varieties. Guo et al (2004b) have tried to exploit this idea by passing Satsuma cytoplasm to ‘Hirado Buntan Pink’ pummelo (Citrus grandis) and two mandarin orange (Citrus reticulata) hybrids; they are currently awaiting fruit to determine whether this was successful. Successful cybrids resulting in a male sterile phenotype due to CMS have been created through protoplast fusion in tobacco (Zubco et al 1996) and rice (Akagi et al. 1995). Somatic cybrids generally posess only one parental chloroplast type after plant regeneration, and there appears to be no inheritance preference. Both parental types are recovered and no recombination is observed. Mitochondria, in contrast, are primarily passed on from the embryogenic callus culture parent, perhaps because embryogenic culture cells tend to have more mitochondria present than leaf cells, and the high quantities of energy that they would provide are necessary for plant regeneration (Moreira et al. 2000). For cybrid verification, therefore, it is necessary to find a polymorphism between the mitochondrial DNA of the two parents and to then demonstrate that the putative cybrid mitochondrial DNA matches only the callus parent.

Angiosperm mitochondrial genome organization and inheritance

The angiosperm mitochondrial genome is generally described in terms of the ‘master chromosome’, a circular molecule of DNA containing a complete set of genes and sets of repeated sequences where recombination commonly occurs between repeat copies (reviewed in Kubo and Newton 2008, Knoop 2004). Because of the frequent recombination of master chromosomes, in actuality the mitochondrial genome of an angiosperm is a mixture of various sized linear and circular DNA molecules (Kmiec et al. 2006). Master chromosomes and subgenomes coexist in a dynamic equilibrium within a mitochondrion, and occasionally recombinant subgenomes present in substoichiometric levels can be transmitted to and disproportionately segregated in daughter cells where they are amplified to become the predominant master chromosome in the next generation (reviewed in Kubo and Newton 2008; Small et al. 1989). Nuclear genes have been implicated in affecting rates of mitochondrial replication, recombination, and even transmission and segregation in progeny (Kubo and Newton 2008).

Despite these occasional rearrangement events, mitochondrial genome organization is generally consistent within a plant genotype, so reliable mtDNA markers for determining inheritance could potentially be very useful. A main challenge in developing consensus markers has been lack of conservation of gene arrangement between taxa. There are typically 50-60 mitochondrial genes in angiosperms; the number difference is mainly in ribosomal protein genes (Kubo and Newton 2008). Because of successive genome recombination events, the arrangement of mitochondrial genes varies significantly between and even sometimes within species, although most of the rearrangements do not affect gene expression and coding sequences themselves remain largely conserved (reviewed in Knoop 2004). Sizable intergenic regions are typically present and have been found to contain nuclear and chloroplast DNA (Allen et al. 2007), as well as additional mt DNA possibly acquired through mitochondrial horizontal gene transfer (Richardson and Palmer 2007). Therefore, although extreme variability in intergenic regions suggests potential for marker development, the lack of gene conservation precludes using them as a common strategy.

Mitochondrial introns

Introns have been found in the mitochondrial genomes of all land plants, and they are primarily group II introns (Michel and Ferat 1995). Group II introns typically have ribozymic self-splicing capabilities for which correct folding into specific secondary structures including numerous stems and loops is essential (reviewed in Bonen 2008, Michel and Ferat 1995). One would therefore expect strict evolutionary constraints on introns to maintain splicing function. There is evidence, however, that some group II introns in plant mitochondria deviate from conventional structures and splicing mechanisms, although it is not entirely clear how this deviant splicing machinery might work. For example, it has been shown that introns fractured due to rearrangements can recognize eachother and reassemble to maintain proper excision in a process called trans-splicing (reviewed in Bonen, 1993 and 2008). Additionally, although typical ribozymic group II introns are excised as lariats, there is evidence in some flowering plants of excised intron structures that are not lariats (Li-Pook-Than and Bonen 2006), which suggests that degenerate plant mitochondrial introns can utilize novel splicing mechanisms in order to maintain gene function and can therefore tolerate more variation (Bonen 2008). In fact, base substitutions are two times higher in plant mitochondrial introns compared to exons (Laroche et al. 1997). This difference is similar to that found in plastids and nuclear genomes, so introns appear to be less constrained in all three genomes. Laroche et al. (1997) also suggest that because introns fix nucleotide and insertion/deletion (indel) mutations more commonly than coding sequences, they could have vast potential value as genetic markers.

Current plant mitochondrial markers

Duminil et al. (2002) identified 35 consensus mitochondrial primer pairs using Arabidopsis thaliana as reference and BLAST with all Viridiplantae sequences available in databases to identify conserved regions. The primers spanned genic, intergenic, and intronic regions, and they successfully amplified on 18 families of angiosperms. They were tested on citrus and only one of the intergenic amplicons (rrn5/rrn18-1) was polymorphic (Froelicher et al. 2011). In order to identify more primer pairs that might be polymorphic in citrus, this group then targeted two intergenic regions and four introns for further primer design, and found three of the intronic regions (nad2/4-3, nad5/2-1, and nad7/1-2) to be polymorphic across a broad range of citrus taxa.

Our approach

My research objective was to develop a larger set of broadly useful plant mitochondrial genetic markers. There is a range of 20-24 total introns among fully sequenced plant mitochondrial genomes [A. thaliana (Unseld et al. 1997), Brassica napus (Handa 2003), Beta vulgaris (Kubo et al 2000), Nicotiana tabacum (Sugiyama et al 2004), Oryza sativa (Notsu et al 2002), Triticum aestivum (Ogihara 2005), and Zea mays (Allen et al 2007)] and I found fourteen introns are common to all of them. I designed primers from conserved flanking gene sequences for each of these introns, tested the primers for amplification across a wide range of plant taxa, and screened for indel polymorphisms within and between selected plant genera.

Materials and Methods

Genetic materials

Genotypes of all DNA used in the Citrus study, cybrid verification study, and cross taxa comparisons are listed in Table 1.

DNA extractions

Total cellular DNA was extracted from citrus callus and leaf tissue according to the protocol of Chen et al (2006) and from Cynodon and Phaseolus species by the protocol of Dellaporta et al. (1991). Total cellular DNA samples of Solanum, Pennisetum and Vaccinium species were provided by Eduardo Vallejos, Maria Gallo, and Jim Olmsted, respectively.

Primer selection and development for the amplification of organelle genic, intergenic and intronic sequences

Fifteen genic, intergenic, and intronic mitochondrial DNA primer pairs were selected from a list of previously published A. thaliana mitochondrial primers (Duminil et al 2002). These primer pairs were for the amplification of: atp9, ccb203, ccb452, cox1, cox3, nad9, orf25 (atp4), rpl5, and rps4 coding sequences; cox2/1-2, cox2/2-3, nad1/2-3, and nad1/4-5 introns; and rps12-1/nad3-2, and rrn5/rrn18-1 intergenic spacer regions. The introns of mitochondrial NADH dehydrogenase subunit 1, 2, 4, 5, and 7 (nad1, nad2, nad4, nad5, and nad7) , cytochrome oxidase subunit 2 (cox2), and cyctochrome c maturation fc (ccmfc) genes were also selected as potential genetic markers because they were common to seven plant species’ complete mitochondrial genomes: A. thaliana (Unseld et al 1997), B. napus (Handa 2003), B. vulgaris (Kubo et al 2000), N. tabacum (Sugiyama et al 2004), O . sativa (Notsu et al 2002), T. aestivum (Ogihara 2005), and Z. mays (Allen et al 2007). The National Center for Biotechnology Information (NCBI) accession numbers for these genomes are NC_001284, NC_002511, NC_008285, NC_006581, NC_007886, NC_007579, and NC_007982, respectively. (). The sequences and the coordinates of introns were located for each species through the annotated mitochondrial RefSeq records. These sequences were extracted and stored in the San Diego Biology Workbench (), where they were aligned by the program ClustalW (Thompson et al 1994). Primer pairs were selected by hand from the highly conserved coding regions flanking intron sequences. The selected primer sequences are summarized in Table 2. Finally, a chloroplast SSR primer pair, CICP9, which is known to be polymorphic in closely related citrus varieties (Cheng et al 2003) was selected to identify chloroplast genome inheritance in putative citrus cybrids.

DNA amplification and fractionation

For the A. thaliana primer sets, DNA was amplified, fluorescently labeled and analyzed by capillary electrophoresis according to the protocol used in Chen et al (2006). Amplification reactions for the mitochondrial introns and chloroplast SSR DNA sequences contained 25-100 ng of DNA, 0.2 µM of each primer, 0.125 mM dNTPs, 1.25 U TAKARA EXTAQ Hot Start DNA polymerase (Clontech, Mountain View, CA) and 1X TAKARA Hot start reaction buffer in a 50-µl reaction volume. Amplification was for 30 cycles of 1 min at 94°C, 2 min at 55°C, and 3 min at 72°C. These amplification products were analyzed by electrophoresis through 6% polyacrylamide gels (Invitrogen Inc. Carlsbad, CA). Electrophoresis was at 90V for 120 min in 1X Tris-Borate-EDTA (TBE) buffer (10 mM Trizma base, 10 mM boric acid, 2.5 mM Na2EDTA, pH 8.2). Gels were stained in 0.5 ug/ml ethidium bromide for 15 min and visualized over a UV transilluminator in a Molecular Imager® Gel Doc™ XR System (Bio Rad Laboratories, Inc. Hercules, CA). Gel images were captured with the Quantity One® 1-D Analysis Software (Bio Rad Laboratories, Inc., Hercules, CA) and exported as .tif files. The DNA Hyperladder II (Bioline Inc., Cambridge, MA) was used as a size marker. The lengths of the marker bands and their corresponding migration distances (mm) were used to plot standard curves in Microsoft Excel. The apparent lengths of amplicons were determined by interpolation from the standard curves.

If there appeared to be a polymorphism between two species but the band sizes were too similar to definitively determine that they were different, then a gel was loaded with a mix of these two species’ PCR products in the same lane to see if two distinct bands appeared.

Results and Discussion

Amplification with published mitochondrial primer sets

Of the 15 primer sets based upon the mitochondrial genome of A. thaliana, all but rps4 and nad1/4-5 primers successfully amplified products on citrus DNA templates. None of these primer sets revealed polymorphisms among the experimental materials in this study, with the exception of the rrn5/rrn18-1 intergenic spacer primer set, which uniquely distinguished mandarin cultivars (C. reticulata) from callus culture #1 and verified cybridization of C. reticulata hybrid leaf parents 'Dancy', 'W. Murcott', 'Osceola', FG303, and FG304 with unidentified callus culture #1. DNA templates prepared from the putative cybrids amplified the 280 bp amplicon characteristic of callus #1 rather than the 275 bp amplicon characteristic of the leaf parents (Table 2).

The highly conserved nature of mitochondrial genes and coding regions (Knoop 2004) explains the lack of polymorphism among amplified genic regions. Because intergenic regions are known to be so variable in plant mitochondrial genomes (Kubo and Newton 2008), it makes sense that the one polymorphic primer pair spanned an intergenic region. Although it is rare to find conserved gene order across families, the rrn5/rrn18-1 and rps12-1/nad3-2 combinations used in this work are two of four total gene clusters that show synteny among N. tabacum, A. thaliana, B. napus, B. vulgaris, and O. sativa (Sugiyama et al 2005) and of six total gene clusters that show synteny among rice, wheat, and maize (Ogihara et al 2005). The short intergenic spacers between these clustered genes suggest that they may be co-transcribed (Sugiyama et al 2005) which could explain the consistency in their arrangement.

Intron amplifications on citrus

Thirteen of fourteen introns successfully amplified products from Citrus DNA templates, and nine of these introns were polymorphic (Table 2, Fig 1). Three of the markers, nad7 intron 1 (nad7i1), nad7 intron 2 (nad7i2) and nad4 intron 1 (nad4i1) showed polymorphism within the genus Citrus as well as between genera Citrus, Poncirus, and Fortunella (Fig 1). Nad7i1 had three groups: P. trifoliata was distinct from a group comprised of kumquat (F. crassifolia 'Meiwa'), pummelo (C. grandis 'Hirado Buntan'), sweet orange (C. sinensis 'Valencia'), grapefruit (C. paradisi), and sour orange (C. aurantium). Mandarin orange (C. reticulata) species comprised a third group. Nad7i2 had three groups as well: P. trifoliata and 'Rough' lemon (C. jambhiri) each had unique amplicons compared to 'Meiwa' kumquat and the remaining Citrus cultivars. Nad4i1 had two groups: one included 'Meiwa' kumquat and 'Rough' lemon, and the other included P. trifoliata and the remaining Citrus cultivars. The remaining six polymorphic markers showed variation only among the three genera.

Cybrid verification

The indel polymorphism within nad7i1 was successful in confirming the cybrids of leaf parents 'Dancy', W. Murcott, 'Osceola', FG303, and FG304 with callus parent #1 (Fig 2,3,4), and the cybrid of leaf parent 'Rough' lemon with callus parent #2 (Fig 5). The estimated lengths of nad7i1 amplicons that were used to verify the recovery of cybrids ranged from 1036 to 1127 base pairs. The indel polymorphisms were therefore estimated to range from 33 to 47 base pairs for this intron. While the lengths of the indel polymorphisms were relatively short, the polymorphisms were readily confirmed by the clear separation of two amplicons in mixtures of PCR amplification products (Fig 2-5). The cybrids of callus parent #1 verified by nad7i1 are in complete agreement with the rrn5/rrn18-1 intergenic spacer results (Table 3). Including results from both rrn5/rrn18-1 and nad7i1, each of the putative cybrids of callus parent #1 was successfully verified by two independent mitochondrial genome markers.

Amplicon size differences confirmed that cybrids of 'Dancy', W. Murcott, and 'Osceola' inherited chloroplasts from the callus parent. Cybrids of FG303 and FG304 inherited chloroplasts from their respective leaf parents. The estimated lengths of amplicons ranged from 226 to 276 base pairs. Polymorphisms were therefore estimated to range from 12 to 26 base pairs. Polymorphisms were again readily confirmed by clear separation of two amplicons in mixtures of PCR amplification products.

The 'Rough' lemon cybrids with callus parent #2 have shown tolerance to citrus canker disease, caused by the bacterium Xanthomonas axonopodis, similar to a hypersensitive type resistance compared to susceptible 'Rough' lemon in preliminary canker screening assays (Marta Francis, personal communication), showing a potential application of cybrid creation and verification using intron based markers.

Cross taxa intron amplifications

To determine the utility of these new plant mitochondrial intron markers across a wider range of taxa, each primer set was tested for ability to amplify intron targets in Cynodon, Solanum, Phaseolus, Pennisetum, and Vaccinium species. Each of the primer sets successfully amplified intron targets on every template tested. Considerable intron length polymorphism was apparent when amplicons were compared between genera. Within genera, however, the only polymorphisms identified through acrylamide gel electrophoresis were found among the Pennisetum species for nad2i4 (Fig 6, 7) and the ccmfc intron (Fig 8, 9). These both distinguished Pennisetum glaucum (pearl millet) 'TifLeaf23' from P. purpureum hybrid 'Merkeron' and P. purpureum hybrid 'Schank'.

Laroche et al. (1997) found that short indels (1-10 bp) comprised greater than 50% of the indels found in the plant mitochondrial introns that they examined, but there were also indels greater than 100 bp present in the introns. Notably, however, their comparisons were all made between genera. Most of the polymorphisms identified in this study were also between genera, whereas relatively little polymorphism was found when comparing within genera and species. This suggests that large indels, which can be easily observed on gels, are tolerated within introns, but rates of such variation are not high within genera. One possible explanation for this observation is that the group II intron splicing requirements (Bonen 2008) constrain variation, especially with respect to large indels.  In addition to requirements for secondary structure, nuclear gene products required to assist in splicing probably evolved in concert with the intron (de Longvialle et al. 2010) and constrain variants that can be successfully spliced.

There does seem to be a much greater degree of tolerance for indels between more distantly related genera. Almost all amplicons show at least some polymorphism between more distant genera, and some of the indels appear to be quite significant in size (Fig 10). This could possibly be explained by the idea that degenerate introns are capable of exploiting diverse and novel splicing mechanisms allowing them to shift away from typical group II ribozymic self splicing (Bonen 2008). Additionally, RNA binding proteins or small RNAs may be able to compensate for evolutionarily weakened structures (Bonen 2008).

Future directions

Based on Laroche et al. (1997), large indels are expected to comprise less than half of the total indels, and indels only comprise between a third and a sixth of the total intron polymorphism in plant mitochondrial introns, so there is potentially much more variation than shown on polyacrylamide gels. Capillary electrophoresis analysis would be useful, since over 50% of indel polymorphisms are 2-10 bp, and these would be difficult to observe by conventional gel electrophoresis. Laroche et al. also showed that indels per site were always lower than base substitutions per site, (two times lower in monocots and five times in dicots) but that frequency of indels correlated with base substitutions in most introns. Based on these data, it is possible that substitution rates, which are higher in frequency than indels, may prove to be more useful than indels as polymorphic markers within genera. Sequencing would therefore be a logical next step in identifying potential single nucleotide polymorphisms (SNPs) as well as small indels. Obvious targets are those introns that have already shown indels since there is a correlation between indels and substitutions. 

In the Laroche et al (1997) study, coxI coding sequences had slower substitution rates in woody perennials compared to herbaceous annuals (presumably due to life history effects, differences in generation time, and population size differences). There were no data comparing woody perennials to annuals with respect to coxI intron polymorphisms, however. Because woody perennials (Citrus and Vaccinium), herbaceous perennials (Cynodon and Pennisetum), and herbaceous annuals (Solanum) were all included in this study, the question of comparative intron substitution rates could be addressed in depth by sequencing the intron amplicons of these species.

Summary:

Through this study, 13 new primer sets were developed for the amplification of mitochondrial introns across a wide array of plant taxa. The large indel polymorphisms identified in plant mitochondrial intron amplicons have proved useful in the confirmation of Citrus cybrids. Furthermore, these primer sets lay the groundwork for the identification of additional useful markers based upon smaller indel and single nucleotide polymoprhisms that will be determined by sequencing.

Table 1. Genetic material

|Citrus Species |

|Fortunella crassifolia 'Meiwa‘ kumquat |

|Poncirus trifoliata |

|Citrus jambhiri, ‘Rough’ lemon |

|Citrus grandis 'Hirado Buntan‘ pummelo |

|Citrus sinensis 'Valencia' |

|Citrus paradisi, grapefruit |

|Citrus aurantium, sour orange |

|Citrus reticulata × C. × limon ‘Ponkan’ |

|Citrus reticulata Blanco ‘Willow leaf’ |

|Citrus reticulata ‘Dancy’ |

|Citrus unshiu ‘Owari’ |

|Citrus unshiu ‘Brown select’ |

|Citrus reticulata ‘Cleopatra’ |

|Cybrids |

|Callus parent #1 |

|Citrus reticulata ‘Dancy’ |

|‘Dancy’ cybrid |

|Citrus reticulata ‘W. Murcott’ |

|‘W. Murcott’ cybrid |

|Citrus reticulata ‘Osceola’ |

|‘Osceola’ cybrid |

|Citrus reticulata FG303 |

|FG303 cybrid |

|Citrus reticulata FG304 |

|FG304 cybrid |

|Callus parent #2 |

|Citrus jambhiri, ‘Rough’ lemon |

|Species used in cross taxa comparisons |

|Citrus grandis ‘Hirado Buntan’ pummelo |

|Citrus reticulata ‘Ponkan’ |

|Citrus sinensis ‘Valencia’ |

|Phaseolus vulgaris , Mesoamerican gene pool ‘XR-235’ |

|Phaseolus vulgaris, Andean gene pool ‘Calima’ |

|Vaccinium corymbosum |

|Vaccinium ashei |

|Vaccinium corymbosum x V. ashei hybrid (direction unknown) |

|Cynodon dactylon |

|Cynodon transvaalensis |

|Cynodon transvaalensis x C dactylon ‘Tifway’ |

|Pennisetum glaucum ‘TifLeaf23’ |

|Pennisetum purpureum hybrid ‘Merkeron’ |

|Pennisetum purpureum hybrid ‘Schank’ |

|Solanum lycopersicum |

|Solanum pennellii |

|Gene |Target |Primer Sequence |Range of |Citrus spp.|Phaseolus |Vaccinium |Cynodon |Pennisetum |

| |Intron |5’-3’ |intron | |spp. |spp. |spp. |spp. |

| | | |lengths | | | | | |

|cox2 |variably | F: GTAGATCCAGCCATTACT |796 – 1463 bp|P |M |M |M |M |

| |located | | | | | | | |

|nad1 |2 | F: CGATCTGCAGCTCAAATGGT |894 – 1422 bp|M |M |M |M |M |

|nad2 |1 | F: GTAATGTGGGTTGGCTTGGA |814 - 1210 bp|P |M |M |M |M |

|nad2 |3 | F: GACCGGATACGAAATCACTG |1906 - 2640 |M |M |M |M |M |

| | | |bp | | | | | |

|nad2 |4 | F: CAGTGGGAGTAGTGACTAG |1388 – 1723 |P |M |M |M |P |

| | | |bp | | | | | |

|nad4 |1 | F: AGGGGCCTTGTGCAGTAAA |1024 - 1471 |P |M |M |M |M |

| | | |bp | | | | | |

|nad4 |3 | F: GCTTAGTAGCCACATTAGC |1655 – 2794 |P |M |M |M |M |

| | | |bp | | | | | |

|nad5 |1 | F: ATGTTTGATGCTTCTTGGGG |831 – 870 bp |P |M |M |M |M |

|nad5 |4 | F: GGTATCTCGTACACATTCCG |928 - 1093 bp|M |M |M |M |M |

|nad7 |1 | F: ACGGAGAAGTGGTGGAACG |813 – 994 bp |P |M |M |M |M |

|nad7 |2 | F: AGATGCCAGCGGAATGAT |927 - 1457 bp|P |M |M |M |M |

|nad7 |3 | F: ATGTTAAGAGGTCGTGCG |990 – 1738 bp|M |M |M |M |M |

Table 3. Capillary electrophoresis allele report for rrn5/rrn18-1 intergenic spacer amplification from cell fusion partners and products verifies ‘Dancy’, ‘W. Murcott’, ‘Osceola’, FG303, and FG304 cybrids with callus parent #1. Cybrid allele sizes match the allele size of the callus parent and differ from respective leaf parents.

|Genotype |Size (bp) |

|Callus parent #1 |280 |

|Dancy |275 |

|Dancy cybrid |280 |

|W. Murcott |275 |

|W. Murcott cybrid |280 |

|Osceola |275 |

|Osceola cybrid |280 |

|FG303 |275 |

|FG303 cybrid |280 |

|FG304 |275 |

|FG304 cybrid |280 |

[pic]

Fig 1. Introns polymorphic for Citrus taxa. Lane 1: Fortunella crassifolia 'Meiwa‘ kumquat; 2: Poncirus trifoliata; 3: Citrus jambhiri, ‘Rough’ lemon; 4: C. grandis 'Hirado Buntan‘ pummelo; 5: C. sinensis 'Valencia'; 6: C. paradisi; 7: C. aurantium; 8: C. reticulata × C. × limon, ‘Ponkan’; 9: C. reticulata Blanco ‘Willow leaf’; 10: C. reticulata ‘Dancy’; 11: C. unshiu ‘Owari’; 12: C. unshiu ‘Brown select’; 13: C. reticulata ‘Cleopatra’.

[pic]

Fig 2. Mitochondrial nad7 intron 1 polymorphisms verify ‘Dancy’-Callus parent #1 cybrids and W. Murcott-Callus parent #1 cybrids. Nad7 intron 1 was amplified from fusion parents and putative cybrids and analyzed by gel electrophoresis. Intron size polymorphisms were confirmed by the presence of two bands in mixtures of PCR products. DNA sample lanes were loaded as follows: 1 ‘Dancy’, 2 Callus #1, 3 ‘Dancy’ – Callus #1 mixture, 4 ‘Dancy’ cybrid, 5 ‘Dancy’ cybrid – ‘Dancy’ mixture, 6 ‘Dancy’ cybrid –Callus #1 mixture, 7 ‘W. Murcott’, 8 Callus #1, 9 ‘W. Murcott’ – Callus #1 mixture, 10 ‘W. Murcott’ cybrid, 11 ‘W. Murcott’ cybrid – ‘W. Murcott’ mixture, 12 ‘W. Murcott’ cybrid – Callus #1 mixture.

[pic]

Fig 3. Mitochondrial nad7 intron 1 polymorphisms verify Osceola-Callus #1 cybrids and FG303-Callus#1 cybrids. Nad7 intron 1 was amplified from fusion parents and putative cybrids and analyzed by gel electrophoresis. Intron size polymorphisms were confirmed by the presence of two bands in mixtures of PCR products. DNA sample lanes were loaded as follows: 1 ‘Osceola’, 2 Callus #1, 3 ‘Osceola’ – Callus #1 mixture, 4 ‘Osceola’ cybrid, 5 ‘Osceola’ cybrid – ‘Osceola’ mixture; 6 ‘Osceola’ cybrid – Callus #1 mixture, 7 FG303, 8 Callus #1, 9 FG303 – Callus #1 mixture, 10 FG303 cybrid, 11 FG303 cybrid - FG303 mixture, 12 FG303 cybrid – Callus #1 mixture.

[pic]

Fig 4. Mitochondrial nad7 intron 1 polymorphisms verify FG304-callus #1 cybrids. Nad7 intron 1 was amplified from fusion parents and putative cybrids and analyzed by gel electrophoresis. Intron size polymorphisms were confirmed by the presence of two bands in mixtures of PCR products. DNA sample lanes were loaded as follows: 1 FG304, 2 callus #1, 3 FG304 – callus #1 mixture, 4 FG304 cybrid, 5 FG304 cybrid - FG304 mixture, 6 FG304 cybrid – callus #1 mixture.

[pic]

Fig 5. Mitochondrial nad7 intron polymorphisms verify Rough Lemon- callus #2 cybrids. The nad7 intron 1 marker verifies mitochondrial inheritance in a citrus cybrid containing Valencia cytoplasm and rough lemon nucleus. Lane 1: Callus #2; 2: ‘Rough’ lemon; 3: Callus #2 and ‘Rough’ lemon mixture; 4: ‘Rough’ lemon cybrid; 5: Callus #2 and ‘Rough’ lemon cybrid mixture; 6: ‘Rough’ lemon and ‘Rough’ lemon cybrid mixture.

[pic]

Fig 6. Nad2i4 on variety of taxa. Lane 1: Citrus grandis; 2: C. reticulata ‘Ponkan’; 3: C. sinensis ‘Valencia’; 4: Phaseolus vulgaris , Mesoamerican gene pool ‘XR-235’; 5: P. vulgaris,  Andean gene pool ‘Calima’; 6: Vaccinium corymbosum; 7: V. ashei; 8: V. corymbosum-V. ashei hybrid (direction unknown); 9: Cynodon dactylon; 10: C. transvaalensis ; 11: C. transvaalensis x C dactylon ‘Tifway’;  12: Pennisetum glaucum ‘TifLeaf23’;  13: P. purpureum hybrid ‘Merkeron’; 14: P. purpureum hybrid ‘Schank’.

[pic]

Fig 7. Mixture confirming nad2i4 polymorphism in Pennisetums. Lane 1: Pennisetum glaucum (pearl millet) ‘TifLeaf23’;  2: P. purpureum hybrid ‘Merkeron’; 3: P. glaucum and P. purpureum mixture.

[pic]

Fig 8. Ccmfc intron on variety of taxa. Lane 1: Citrus grandis; 2: C. reticulata ‘Ponkan’; 3: C. sinensis ‘Valencia’; 4: Vaccinium corymbosum; 5: V. ashei; 6: V. corymbosum-V. ashei hybrid (direction unknown); 7: Cynodon dactylon; 8: C. transvaalensis ; 9: C. transvaalensis x C dactylon ‘Tifway’;  10: Pennisetum glaucum ‘TifLeaf23’;  11: P. purpureum hybrid ‘Merkeron’; 12: P. purpureum hybrid ‘Schank’.

[pic]

Fig 9. Mixture confirming ccmfc polymorphism in Pennisetums. Lane 1: Pennisetum glaucum (pearl millet) ‘TifLeaf23’;  2: P. purpureum hybrid ‘Merkeron’; 3: P. glaucum and P. purpureum mixture.

[pic]

Fig 10. Nad4i1 on variety of taxa. Large indels of up to 400 bp are present between distantly related genera. Lane 1: Citrus grandis; 2: C. reticulata ‘Ponkan’; 3: C. sinensis ‘Valencia’; 4: Phaseolus vulgaris , Mesoamerican gene pool ‘XR-235’; 5: P. vulgaris,  Andean gene pool ‘Calima’; 6: Vaccinium corymbosum; 7: V. ashei; 8: V. corymbosum-V. ashei hybrid (direction unknown); 9: Cynodon dactylon; 10: C. transvaalensis ; 11: C. transvaalensis x C dactylon ‘Tifway’;  12: Pennisetum glaucum ‘TifLeaf23’;  13: P. purpureum hybrid ‘Merkeron’; 14: P. purpureum hybrid ‘Schank’.

References

Akagi H, Nakamura A, Sawada R, Oka M, Fujimura T. (1995). Genetic diagnosis of cytoplasmic male sterile cybrid plants of rice. Theor. Appl. Genet., 90, 948-951.

Allen JO, Fauron CM, Minx P, Roark L, Oddiraju S, Lin GL et al (2007). Comparisons among two fertile and three male-sterile mitochondrial genomes of maize. Genetics 177: 1173-1192.

Bonen L (2007) Cis- and trans-splicing of group II introns in plant mitochondria. Mitochondrion 8: 26-34.

Bonen L (1993) Trans-splicing of pre-mRNA in plants, animals, and protists. FASEB J 7: 40-46.

Chen C, Zhou P, Choi YA, Huang S, Gmitter Jr. FG (2006) Mining and characterizing microsatellites from citrus ESTs. Theor. Appl. Genet. 112: 1248-1257.

De Lonvialle A, Small I, Lurin C (2010) Nuclearly encoded splicing factors implicated in RNA splicing in higher plant organelles. Molecular Plant 3(4): 691-705.

Dellaporta SL, Moreno MA, Delong A. (1991) Cell lineage analysis of the gynoecium of maize using the transposable element Ac. Dev Suppl. 1:141-7.

Duminil J, Pemonge M-H, Petit RJ (2002) A set of 35 consensus primer pairs amplifying genes and introns of plant mitochondrial DNA. Molec Ecol Notes 2: 428-430.

Froelicher Y, Mouhaya W, Bassene J, Constantino G, Kamiri M, Luro F, Morillon R, Ollitrault P (2010) New universal mitochondrial PCR markers reveal new information on maternal citrus phylogeny. Tree Genetics & Genoics 7: 49-61.

Guo WW, Cai XD, and Grosser JW (2004a). Somatic Cell Cybrids and Hybrids in Plant Improvement. Ch. 24, Pp. 635-659. IN: Daniell, H. and C.D. Chase (Eds.). Molecular Biology and Biotechnology of Plant Organelles. Kluwer Academic Publisher, Dordrecht, The Netherlands.

Guo WW, Prasad D, Cheng YJ, Serrano P, Deng XX, Grosser JW. (2004b). Targeted cybridization in citrus: transfer of Satsuma cytoplasm to seedy cultivars for potential seedlessness. Plant Cell Rep 22:752-758.

Handa, H. (2003). The complete nucleotide sequence and RNA editing content of the mitochondrial genome of rapeseed (Brassica napus L.): comparative analysis of the mitochondrial genomes of rapeseed and Arabidopsis thaliana. Nucleic Acids Research 31: 5907-5916.

Kmiec B, Woloszynska M, Janska H (2006). Heteroplasmy as a common state of mitochondrial genetic information in plants and animals. Curr. Genet. 50, 149–159.

Knoop V (2004) The mitochondrial DNA of land plants: peculiarities in phylogenetic perspective. Curr Genet 46: 123-129.

Kubo T and Newton K (2008) Angiosperm mitochondrial genomes and mutations. Mitochondrion 8: 5-14.

Kubo T, Nishizawa S, Sugawara A, Itchodo N, Estiati A, and Mikami T(2000). The complete nucleotide sequence of the mitochondrial genome of sugar beet (Beta vulgaris L.) reveals a novel gene for tRNACys(GCA). Nucleic Acids Research 28: 2571-2576.

Laroche J, Li P, Maggia L, Bousquet J (1997). Molecular evolution of angiosperm mitochondrial introns and exons. Proc. Natl. Acad. Sci. 94: 5722-5727.

Li-Pook-Than J, Carrillo C, Bonen L, (2004). Variation in mitochondrial transcript profiles of protein-coding genes during early germination and seedling development in wheat. Curr. Genet. 46, 374–380.

Michel F and Ferat J (1995) Structure and activities of group II introns. Annu. Rev. Biochem. 64: 435-461.

Notsu Y, Masood S, Nishikawa T, Nubo K, Akiduki G, Nakazono M, Hirai A, and Kadowaki K (2002). The complete sequence of the rice (Oryza sativa L.) mitochondrial genome: frequent DNA sequence acquisition and loss during the evolution of flowering plants. Mol Gen Genomics 268: 434-445.

Ogihara Y, Yamazaki Y, Murai K, Kanno A, Terachi T, Shiina T et al (2005). Structural dynamics of cereal mitochondrial genomes as revealed by complete nucleotide sequencing of the wheat mitochondrial genome. Nucleic Acids Research 33:6235-6250.

Rajendrakumar P, Biswal AK, Balachandran SM, Ramesha MS, Viraktamath BC, Sundaram RMA (2007) Mitochondrial repeat specific marker for distinguishing wild abortive type cytoplasmic male sterile rice lines from their cognate isogenic maintainer lines. Crop Sci 47:207–211

Richardson AO, Palmer JD (2007). Horizontal gene transfer in plants. J. Exp. Bot. 58, 1–9.

Saito W, Ohgawara T, Shimizu J, Kobayashi S (1993) Citrus cybrid regeneration following cell fusion between nucellar cells and mesophyll cells. Plant Sci 88:195-201.

Schuster W, Brennicke A (1994) The plant mitochondrial genome: physical structure, information content, RNA editing, and gene migration to the nucleus. Annual Review of Plant Physiology and Plant Molecular Biology, Plant Molecular Biology, 45, 61-78.

Small I, Suffolk R, Leaver CJ (1989.) Evolution of plant mitochondrial genomes via substoichiometric intermediates. Cell 58, 69–76.

Sperisen C, Büchler U, Gugerli F, Mátyás G, Geburek T, Vendramin GG (2001) Tandem repeats in plant mitochondrial genomes: application to the analysis of population differentiation in the conifer Norway spruce. Molecular Ecology 10: 257-263.

Sugiyama Y, Watase Y, Nagase M, Makita N, Yagura M, Hirai A, and Sugiura M (2005). The complete nucleotide sequence and multipart organization of the tobacco mitochondrial genome: comparative analysis of mitochondrial genomes in higher plants. Mol Gen Genomics 272: 603-615.

Thompson JD, Higgins DG, Gibson TJ (1994) CLUSTAL W: improving the sensitivity of progressive multiple sequence alignment through sequence weighting, position-specific gap penalties and weight matrix choice. Nucleic Acids Res. 22:4673-4680.

Unseld M, Marienfeld JR, Brandt P, Brennick A (1997). The mitochondrial genome of Arabidopsis thaliana contains 57 genes in 366,924 nucleotides. Nature Genetics 15: 57-61.

Wolfe KH, Li WH, Sharp PM (1987) Rates of nucleotide substitution vary greatly among plant mitochondrial, chloroplast, and nuclear DNAs. Proc. Natl. Acad. Sci. USA 84, 9054–9058.

Zubko MK, Zubko EI, Patskovsky YV, Khvedynich OA, Fisahn J, Gleba YY, Schieder O (1996). Novel 'homeotic' CMS patterns generated in Nicotiana via cybridization with Hyoscyamus and Scopolia. J. Exp. Bot., 47, 1101-1110.

Acknowledgements

I acknowledge funding from the Undergraduate Science for Life Program, an interdisciplinary program in the life sciences with support from Howard Hughes Medical Institutes, and from the University’s Scholars Program, an undergraduate research program with support from the University of Florida. I am extremely grateful for the patient guidance and support from Dr. Christine Chase over the past three years. Thank you to the members in the Chase Lab for their advice and support: Yoland Lopez, Karen Chamusco, and Kanchan Singh, and to Kyra Love for help with technical work. Thank you also to Dr. Fred Gmitter, Dr. Chunxian Chen, and Dr. Jude Grosser for their help with the cybrid studies and providing Citrus DNA samples, and to Drs. Eduardo Vallejos, Maria Gallo and Jim Olmsted for providing DNAs of Solanum, Pennisetum and Vaccinium species, respectively.

-----------------------

1 kb

Table 2. Summary of target introns and results. M6Nho % & 2 3 W \ ` ? ‘ Ÿ Ro˜

-

/

†

?

½

¾

Ë

á

æ

E

J

öîãîãÛîöÒƺ«º«Ÿº«“‡“{oaº«º«º«U«UhA0ºB*[pic]CJPJphhã3ª6?B*[pic]CJPJphhã3ªB*[pic]CJPJphhÅ;©B*[pic]CJPJphh×P$B*[pic]CJPJphhX2B*[pic]CJPJphh4

ŸB*[pic]CJPJphh°`Êh°`ÊB*[pic]CJPJphh°`ÊB*[pic]CJPJphhŠ[Éh¬¿5?CJaJh°`Ê5?CJaJ

he~-C=monomorphic, P=polymorphic.

1 kb

1 kb

1 kb

1 kb

600 bp

................
................

In order to avoid copyright disputes, this page is only a partial summary.

Google Online Preview   Download