DNA profiling activity - PDST



DNA profiling activity

This activity illustrates the action of a restriction enzyme and electrophoresis. Single stranded DNA is used to simplify the exercise.

Crime investigation - A murder has been committed. DNA has been extracted from the blood of the victim and blood found at the scene and DNA samples have been taken from 2 suspects.

Materials per group (four)

DNA samples - 2 identical and 2 different (victim, blood at scene, suspect 1, suspect 2)

Scissors

1. Take a DNA sequence. Look for the target sequence GATC and cut between G and A.

2. Count the number of bases in each piece and write it on the back together with the source.

3. Note the number on the longest piece. Draw a rectangle on a page making it the same length + 2 (in cm). Mark the cm divisions along the side with zero at the top end of the rectangle. Divide it into 4 columns and label each column - victim, evidence, suspect 1, suspect 2.

4. Arrange the pieces of each DNA sample in its own column and opposite the number which represents the number of bases in it.

5. Compare the band patterns of all and make appropriate deductions.

Blood at scene - DNA

AGATCCGTATGATCAATTCGGTACGAGATCGGTTATGATCGGATTAGCTTACGGATCCGATCTAGCGC

Victim's DNA

CGATAGGATCCGACGGTTCATGTAGCTGATCTTGGTGCGATATGTACGTATGATCGAATTATGCGCGC

Suspect 1

AGATCCGTATGATCAATTCGGTACGAGATCGGTTATGATCGGATTAGCTTACGGATCCCGATCTAGCG

Suspect 2

AACGATCGTAATGATCAATTCGGTACTTGAGAGATCGGTTATGATCGGATTAGCCTTACGGATCCCGA

................
................

In order to avoid copyright disputes, this page is only a partial summary.

Google Online Preview   Download