DNA profiling activity - PDST
DNA profiling activity
This activity illustrates the action of a restriction enzyme and electrophoresis. Single stranded DNA is used to simplify the exercise.
Crime investigation - A murder has been committed. DNA has been extracted from the blood of the victim and blood found at the scene and DNA samples have been taken from 2 suspects.
Materials per group (four)
DNA samples - 2 identical and 2 different (victim, blood at scene, suspect 1, suspect 2)
Scissors
1. Take a DNA sequence. Look for the target sequence GATC and cut between G and A.
2. Count the number of bases in each piece and write it on the back together with the source.
3. Note the number on the longest piece. Draw a rectangle on a page making it the same length + 2 (in cm). Mark the cm divisions along the side with zero at the top end of the rectangle. Divide it into 4 columns and label each column - victim, evidence, suspect 1, suspect 2.
4. Arrange the pieces of each DNA sample in its own column and opposite the number which represents the number of bases in it.
5. Compare the band patterns of all and make appropriate deductions.
Blood at scene - DNA
AGATCCGTATGATCAATTCGGTACGAGATCGGTTATGATCGGATTAGCTTACGGATCCGATCTAGCGC
Victim's DNA
CGATAGGATCCGACGGTTCATGTAGCTGATCTTGGTGCGATATGTACGTATGATCGAATTATGCGCGC
Suspect 1
AGATCCGTATGATCAATTCGGTACGAGATCGGTTATGATCGGATTAGCTTACGGATCCCGATCTAGCG
Suspect 2
AACGATCGTAATGATCAATTCGGTACTTGAGAGATCGGTTATGATCGGATTAGCCTTACGGATCCCGA
................
................
In order to avoid copyright disputes, this page is only a partial summary.
To fulfill the demand for quickly locating and searching documents.
It is intelligent file search solution for home and business.
Related searches
- dna and protein synthesis worksheet
- dna central dogma of biology
- worksheet on dna rna protein synthesis answer
- dna rna and protein synthesis answer key
- worksheet on dna rna and protein synthesis
- dna and rna khan academy
- dna synthesis khan academy
- dna protein synthesis activity
- dna and protein synthesis quiz
- dna and protein synthesis article
- activity websites for activity directors
- activity resources for activity directors