Normal.dot - Osteoarthritis



Supplemental MaterialContinuation: Peptide synthesis and characterizationStapled peptides, referring to an all-hydrocarbon brace at one (single stapled) or more (e.g. double stapled) positions of the α-helical peptide (1-3), exhibited increased conformational and functional stability, binding affinity, and cell penetration via endocytosis compared to others (1-3). 1. Hahne, G. and T.N. Grossmann, Direct targeting of beta-catenin: Inhibition of protein-protein interactions for the inactivation of Wnt signaling. Bioorg Med Chem, 2013. 21(14): p. 4020-6.2. Takada, K., et al., Targeted disruption of the BCL9/beta-catenin complex inhibits oncogenic Wnt signaling. Sci Transl Med, 2012. 4(148): p. 148ra117.3. Grossmann, T.N., et al., Inhibition of oncogenic Wnt signaling through direct targeting of beta-catenin. Proc Natl Acad Sci U S A, 2012. 109(44): p. 17942-7.Peptides were synthesized as recently reported (Dietrich, L., et al., Cell Permeable Stapled Peptide Inhibitor of Wnt Signaling that Targets beta-Catenin Protein-Protein Interactions. Cell Chem Biol, 2017. 24(8): p. 958-968 e5.). Peptide synthesis was performed on Rink amide NovaSyn TGR (Merck). Amino acids were dissolved in NMP and coupled twice or three times. For coupling, amino acids were mixed with 3.9 eq of PyBOP and 8 eq of DIPEA in NMP and added to the resin for 40 min. After amino acid coupling, the remaining free amino groups were blocked with NMP/acetic anhydride/DIPEA (10/1/1) for 10 min. Fmoc-deprotection was performed with 25 % piperidine in NMP for 10 min. Crosslinking of unnatural olefinic amino acids was performed by ring-closing metathesis (RCM). The dried resin was swollen in DCE for 30 min. A solution of Grubbs 1st generation catalyst (4 mg/mL) in DCE was added to the resin and reacted for 1 h at room temperature. During reaction, nitrogen was bubbled through the mixture. The procedure was repeated five times and the resin was washed in a DMSO/DCM (1/1) solution for 10 min followed by a washing step in DCM. For acetylation, the last Fmoc protecting group was removed and the free N-terminus was reacted twice with NMP/acetic anhydride/DIPEA (10/1/1) for 10 min. FITC labeling:Fmoc-O2Oc-OH was coupled as a spacer to peptides subjected to FITC modification. FITC-labelling was performed twice with a 4-fold excess of FITC Isomer I and 8 eq. DIPEA in NMP for 1 h. Peptides were cleaved from the resin with TFA/H2O/TIPS (95/2.5/2.5) for 4 h and precipitated with diethyl ether at -20_C. Semi preparative HPLC was carried out on a LC-8A system (Shimadzu) using a Nucleodur C18 reverse-phase column (10 x 125 mm, particle size 5 mm, Macherey-Nagel; solvent A: water + 0.1%TFA; solvent B: acetonitrile + 0.1%TFA; flow rate: 6mL?min-1). Products were characterized on an analytical 1260 Infinity HPLC/ESI system (Agilent Technologies) equipped with a Zorbax C18 reverse-phase column (4.6 x 150 mm, particle size 5 mm, Agilent Technologies; solvent A: water + 0.1 % TFA; solvent B: acetonitrile + 0.1 % TFA; flow rate: 1mL?min-1). According to Lambert-Beer law, yields were quantified by UV absorbance at 280 nm with an extinction coefficient of 11,000 M-1?cm-1 (StAx). FITC-labeled peptides were measured at 495 nm in 100 mM sodium phosphate buffer (pH 8.5) and calculated with an extinction coefficient of 77.000 M-1?cm-1. Acetylated SAH-Bcl9 was quantified by weight. Analytical data are shown in Table 1.Table 1: List of peptides and analytical data. Peptide purity and identity was assessed via HPLC-ESI/MS. Peptides feature C-terminal amides, Mw = Molecular weight / g?mol-1, * = (S)-N-Fmoc-2-(4?-pentenyl)alanine, FITC = fluorescein isothiocyanate, PEG2 = 8-amino-3,6-dioxyoctanoyl, Ac = acetyl group, B = NorleucinePeptide Sequence Mw / g?mol-1 found m/z calc. m/z f-StAx-35RFITC-PEG2-RRWPR*ILD*HVRRVWR 2885,4 722,4/578,1 722,3/577,9 Ac-StAx-35R Ac-RRWPR*ILD*HVRRVWR 2392,9 599,2 599,1 f- SAH-Bcl9FITC-PEG2-LSQEQLEHRERSL*TLR*IQRBLF3550,11183,9/888,41814,4/888,5Ac-SAH-Bcl9Ac-LSQEQLEHRERSL*TLR*IQRBLF3057,61529,7/1020,01529,8/1020,2Abbreviations:ACN acetonitrile DCE 1,2-dichloroethane DCM dichloromethane DIPEA N,N-diisopropylethylamine DMSO dimethyl sulfoxide eq equivalent ESI electrospray ionisation FITC Fluorescein isothiocyanate isomer I Fmoc 9-fluorenylmethoxycarbonyl HPLC high performance liquid chromatography MS mass spectrometry NMP N-methyl-2-pyrrolidone OxymaPure? Ethyl (hydroxyimino)cyanoacetate PEG polyethylene glycol PyBOP benzotriazole-1-yl-oxy-tris-pyrrolidino-phosphonium hexafluorophosphate RCM ring closing metathesis * (S)-N-Fmoc-2-(4?-pentenyl)alanine SPPS solid-phase peptide synthesis TFA trifluoroacetic acid Table 2: Murine Primers for quantitative Real-Time PCRGene (product length)Sequence (in 5’ – 3’ direction)AcanforwardGAAGAGCCTCGAATCACCTG(132 bp)reverseATCCTGGGCACATTATGGAACol2a1(69 bp)forwardreverseCATGAACGGTGGCTTCCACTTCATCTGGACGTTAGCGGTGTTGGCol10a1(243 bp)forwardreverseCCATACGCCATAAAGAGTAAAGGGGTGTCCATATGGTCCTCTCTCCGapdh(84 bp)forwardreverseAGCAAGGACACTGAGCAAGAGAGGGGGTCTGGGATGGAAATTGTGAGGSox9forwardTATGTGGATGTGTGCGTGTG(137 bp)reverseCCAGCCACAGCAGTGAGTAATable 3: Human Primers for quantitative Real-Time PCRGene (product length)Sequence (in 5’ – 3’ direction)ACANforwardCTCCGGAATGGAAACGTGAATC(218 bp)reverseCTGGTAGTCTTGGGCATTGTTGCOL2A1(126 bp)forwardreverseCTGGAAAGCCTGGTGATGATGGTGTGTGACCTTTGACACCAGGAAGGCOL10A1(267 bp)forwardreverseAATCCCTGGACCGGCTGGAATTTCTTGATGCCTGGCTGTCCTGGAACCGAPDH(90 bp)forwardreverseCCCACTCCTCCACCTTTGACAGCCAAATTCGTTGTCATACCAGSOX9forwardGAGAGCGAGGAGGACAAGTTC(263 bp)reverseTCGCTCTCGTTCAGAAGTCTCSupplemental FiguresSuppl. Figure 1: According to the Wnt3a induced β-catenin reporter assay in Figure 1B: Low (10?ng/ml) and high (100?ng/ml) Wnt3a dosages significantly upregulated the β-catenin specific reporter assaySuppl. Figure 2: Treatment with 100?ng/ml recombinant Wnt3a of primary murine chondrocytes significantly upregulated Col10a1 expression, as marker gene for hypertrophy and chondrocyte catabolism. Col10a1 gene expression remained unchanged when low dosage of Wnt3a (10?ng/ml) was applied. ................
................

In order to avoid copyright disputes, this page is only a partial summary.

Google Online Preview   Download