Novel Mutations on beta-Myosin Heavy Chain and Cardiac ...
Supplementary Table S1.Primer design and DHPLC conditions for MYH7. Exon Primers Product size (bp) Tm (°C) Forward Reverse 1 (5'UTR) catatatacagcccctgagacca cttatcccagagtaaagcctccag 112 60 2 (5 ... ................
................
To fulfill the demand for quickly locating and searching documents.
It is intelligent file search solution for home and business.
Related searches
- cardiac hypertrophy on ekg
- cardiac ischemia and cardiac infarction
- foods allowed on cardiac diet
- cardiac ischemia on ekg
- beta glucan and cancer
- beta glucan and cancer benefits
- beta glucan and cancer treatment
- beta glucan and prostate cancer
- epinephrine and cardiac arrest
- stomach feels heavy and uncomfortable
- beta hcg and intrauterine pregnancy
- supply chain structures and relationships