Introduction:



Supplemental materials and methods

Phylogenetic Analysis

Sequences were retrieved using PSI-BLAST searches at the NCBI (Schäffer et al. 2001). Sequences were trimmed down to the NTP_transf_2 and PAP_associated domain prior to phylogenetic analysis. Multiple sequence alignments were done using MAFFT (Katoh et al. 2002) and badly aligned regions were removed using the GBLOCKS server (Castresana 2000) with relaxed settings. A distance-based tree was constructed using the Phylip package with 500 iterations (Felsenstein 1989). Tree visualization was done using Dendroscope (Huson et al. 2007) and modified in Illustrator CS2 (Adobe). Orthologous proteins in C. briggsae and C. remanei are present but not shown.

Strains

To generate the gld-2(ef15) gld-4(q497) double mutant we screened for a recombination event between the gld-2 and the gld-4 locus on LG I. The gld-4(ef15) deletion was followed by genomic PCR using primers CE491 (gaaccacttgttctcctgctc), CE492 (cctatggatccgtccttttgctcg), CE493 (gggcattttctgatagggagtg) and CE494 (cagcttgagcagcgagagttcg). The gld-2(q497) point mutation was determined by sequencing the genomic locus in the region of the point mutation introducing a premature stop codon. The double mutant was balanced over hT2g (I;III) and all homozygote gld-2 gld-4 mutants animals were the progeny of heterozygote balanced animals.

The gld-2(ef15) gld-4(q497); fbf-1(ok91) fbf-2(q704) strain is balanced by a linked GFP transgene (ccIs4251) closely linked to unc-15(e73) for mutations on LGI, and balanced for genes on LGII using mIn1[mIs14 dpy-10(e128)]. The presence of all mutations was validated by PCR for deletions or by sequencing for q704 and q497 after crossings. Quadruple homozygotes are non-green.

The fog-2(q71) mutation is marked with a closely linked unc-51(e1189) mutation and introduced by crossing into the background of gld-2(ef15) gld-4(q497)/hT2g. Non-green uncoordinated homozygote animals were analyzed as staged adults. Strains were cultured at 20C unless stated otherwise and handled according to standard methods (Brenner, 1974).

RNAi feeding constructs and procedures

A largely full-length open reading frame of fog-1 and ccr-4 was taken from cloned cDNAs. The cDNA inserts were moved into the multiple cloning site of pL4440 with appropriate restriction enzymes and verified by sequencing. Plasmid DNA was introduced into HT115(DE3) E.coli cells and induced with IPTG according to standard methods. For ccr-4 feeding experiments, homozygote gld-2 gld-4 L2/L3 animals were feed for 48 hours at 20C and subsequently analysed. For fog-1(RNAi), heterozygote gld-2 gld-4/hT2g mothers were placed on feeding plates. Their homozygote mutant adult progeny was analysed 24hrs past L4 stage.

Immunocytochemistry of embryos and extruded germ lines

Germline stainings: Animals were cut in M9 containing 0.25mM levamisole on poly-lysine subbed slides, fixed with 1-2% PFA and processed as in (Crittenden and Kimble 1999). Fluorophor coupled secondary antibodies (Jackson Labs) were diluted 1:800 in PBS/0.5%BSA containing DAPI (1ng/ml). Subsequently, germ lines were washed 3 times for 10 minutes with PBSB and mounted in Vectashield (Vecta Labs). Antibodies against GLD-1, HIM-3 and PGL-1 were used as described (Jones et al. 1996; Kawasaki et al. 1998; Zetka et al. 1999). The anti-Phospho Histone-3 antibody (6G3) was purchased from CellSignaling. Anti-GLD-1 antibodies were a gift of Tim Schedl and are described in (Jones et al. 1996). For GLD-1 quantifications we counterstained with antibodies recognizing PGL-1 (a guinea pig antiserum raised against two PGL-1 peptides of its extreme N-terminus) and Mab414, a mouse monoclonal antibody recognizing nuclear pore structures (Covance).

Embryo stainings: Gravid adult worms were cut on a coverslip in M9 containing 0.25mM levamisole, freeze cracked and processed as in (Crittenden and Kimble 1999). Primary antibodies over night at 4C: anti-GLD-4 (rb449788 at 1:2500, rbA161 at 1:600) and anti-PGL-1 at 1:500 dilution. The blocking peptide used was a MBP-GLD-4 fusion piece covering the epitope produced and purified from BL21 E.coli.

Immunoprecipitation from worm extract

Worm extract: A 2ml worm pellet was resuspended in 4ml IP Buffer B70 (50mM Hepes-KOH pH7.4, 70mM KOAc, 1mM NaF, 20mM (-glycerolphosphate, 5mM MgOAc, 0.1% Triton, 10% Glycerol), frozen in liquid nitrogen and ground in liquid nitrogen using a mortar and pestle. The on ice thawed worm powder was centrifuged at 16 000g for 30 minutes. Filtered (0.45mm) extract supernatant contained on average 20mg/ml protein and was aliquoted in 500ml fractions and stored at -80C.

RNA co-IP: Per IP reaction a single aliquot was thawed on ice and pre-incubated with Protein-A agarose (Roche) for 20 minutes at 4C. Pre-cleared supernatant was incubated for 2 hours at 4C with respective antibodies. Antibody/protein complexes were captured on Protein-A agarose for 1 hour and further cleaned via three washing steps of 1ml B300 buffer (50mM Hepes-KOH pH7.4, 300mM KOAc, 1mM NaF, 20mM (-glycerolphosphate, 5mM MgOAc, 0.1% Triton, 10% Glycerol). The bead bound RNA was eluted in 200ml Trizol (Invitrogen) for 10 minutes at 65C following the manufacturers protocols for RNA isolation. RNA was precipitated in the presence of 40ug glycogen at 12000g for 10 minutes at 4C and washed with 75% ethanol. Air-dried RNA was resuspended in 15ml DEPC treated H2O and DNAse I (Roche) treated prior to a phenol-chloroform extraction and an ethanol precipitation. Subsequently, a cDNA synthesis was carried out in a 20ml reaction volume using an oligo dT anchor primer (Roche) and AMV Reverse Transcriptase (Promega) according to standard procedures.

Protein IP: For the detection of co-purified proteins the specific antibodies were covalently coupled to Protein-A agarose (Roche) in the presence 20mM Dimethyl-pimelimidate-dihydrochloride (Sigma) according to standard protocols. Subsequently, beads were quickly washed in 0.1M glycin pH 3.0 and equilibrated in B70 buffer. Pre-cleared worm extract was incubated with antibody-coupled beads for 1 hour at 4C. Beads were washed 3x for 10 minutes each in B70 buffer and boiled in 25ml 2x SDS sample buffer. For Figure 3D and 3E, one third of the material was resolved on an 8% SDS/PAGE gel and probed by immunoblotting with antibodies directed against GLD-4 (mo402A42-3) and GLS-1 (rbC5C0) (Rybarska et al., submitted elsewhere).

Immunoprecipitation from SF+ cells: 200ml SF+ cells (Invitrogen) where grown to a density of 106 and infected with 250ml of each P3 baculovirus stock. Protein expression took 3 days at 27C. Cells where harvested and resuspended in 5ml lysis buffer (50mM Hepes-KOH pH 7.4, 5% glycerol, 100mM NaCl, 0.1% X-100, 1mM DTT, Complete Protease inhibitors (Roche) and E64 (Biomol)). For each IP, 500ml of frozen extract was pre-cleared at 16000g for 15 minutes at 4C. Proteins were isolated from the supernatant using antibodies coupled to Protein A-agarose beads for 1 hour. Beads where washed 5x in 2xPBS containing 0.2% X-100 and boiled in 50ml of 2xSDS sample buffer. 1/5 of the IP was loaded on a 8% SDS/PAGE gel and probed by immunoblotting using GLD-4 (mo402A42-3), GLS-1 (rbC5C0) and GFP (sc-9996, Santa Cruz) antibodies. Equal protein expression was determined by immunoblotting and subsequent probing with penta-His (Qiagen) and Maltose-Binding-protein (NEB) antibodies or a-Tubulin antibodies (Sigma).

RNA isolation from worms and gene specific RT-PCR

Worms where grown to adult stage and individually harvested by picking. Total RNA from the equivalent to 40 wild-type hermaphrodites was isolated using Trizol reagents (Invitrogen) and purified using standard phenol chloroform and ethanol precipitation protocols. For cDNA synthesis, AMV Reverse transcriptase (Promega) and oligo dT primers were used according to manufacturers instructions. Semi-quantitative PCR amplification was carried out with 1ul of cDNA and nested PCR Primer sets with a low number of amplification cycles each (approx. 10-15 cycles) and an annealing temperature of 58C. The entire 20ml PCR reaction was resolved on 1.2% Agarose gels. At minimum three independent experiments were performed for all given experiments. PCR products were imaged with a 14bit CCD camera (Vilber Lourmat, France) and desitometric quantification was carried out with Adobe Photoshop. Primer sequences are available upon request.

MS2 tethering experiments

mRNA reporter plasmids: Three different RNA substrates were used for the tethering assay. pLucF (firefly Luciferase) is a kind gift of Stefan Hüttelmaier (Univ. of Halle). The LucF ORF is inserted into pcDNA3.1 (Invitrogen) and flanked by a T7 promoter and a 3’UTR sequence from beta-actin cDNA that contains six copies of MS2 binding sites (MS2bs) in tandem. The short 6xMS2bs substrate RNA was generated by removing the LucF ORF between the BamH I and Hind III sites and subsequent recircularization. Both plasmids were linearized with Hpa I and in vitro transcribed with T7 RNA polymerase. In the case of the short 6xMS2bs RNA, the RNA was transcribed in the presence of [α-32P] UTP. pLucR (renilla Luciferase) was created by inserting the LucR ORF into pTNT which contains a 30nt long stretch of poly(A) (Promega). pLucR was linearized with NotI and in vitro transcribed with T7 RNA polymerase.

MS2 protein fusions and GLS-1: The D215A mutant version of hsPAPD4 in pCS2+ was a kind gift of Marvin Wickens and is described in (Kwak et al. 2004). Wild-type hsPAPD4 was derived from it by employing a site directed mutagenesis protocol (Stratagene). Wild-type and D141A mutant derivatives of GLD-4 were fused by replacing hsPAPD4 through NheI and XbaI. All plasmids generate N-terminal fusions with a double HA-epitope tag followed by the MS2 coat protein. Capped mRNA was in vitro transcribed using SP6 RNA polymerase and NotI linearized plasmids. GLS-1 was subcloned from a full-length cDNA clone by PCR and incorporated downstream of 7 myc epitope tags into a modified pTNT vector (Promega) that contains the 3’UTR of Xenopus NO38 cDNA (Peculis and Gall 1992) and a poly(A) tail of 47 adenosines termed pTNT(No38pA47). A similar clone was made from a gls-1(ef4) cDNA (Rybarska et al., submitted elesewhere). The plasmid was linearized with EcoRV and transcribed with T7 RNA polymerase in vitro into capped mRNA.

mRNA injection and manipulation of Xenopus oocytes: Healthy stage VI Xenopus oocytes were injected with 150ng RNA encoding the MS2 fusion proteins. 150ng GLS-1 mRNA was injected 3hrs prior to the test proteins. The LucF (40ng) and LucR (25ng) reporter RNAs were coinjected another 3 hrs later. In order to study the molecular changes on the RNA substrate, 50ng per oocyte of the short 6x MS2bs radiolabeled RNA was injected.

RNA analysis: Total RNA was prepared from a batch of 15-20 oocytes using TRIZOL reagents (Invitrogen). After Isopropanol precipitation, the RNA was solubilized in 50μl of water. Polyadenylated RNA was separated from nonpolyadenylated RNA with oligo(dT) 25 magnetic beads, following the manufacturer’s instructions (Dynal Biotech). RNA was eluted in water and subsequently by addition of denaturing RNA loading buffer and both eluates were separated on a 5% denaturing polyacrylamide gel and analyzed by autoradiography. The supernatants of all binding and washing steps were collected, Ethanol precipitated and 1/20 was loaded onto the same polyacrylamide gel to check for RNA integrity.

Luciferase assay: A minimum of 8 oocytes was pooled and assayed per experimental point. Oocytes were homogenized in NP40 buffer (10ul buffer/oocyte). Aliquots of 5µl were assayed separately for firefly and renilla luciferase activity (Promega). Absolute light determinations were measured in a Genios Pro luminescence reader. Firefly luciferase activities were normalized to measured renilla luciferase activities among measured pools. With the exception of lane 4 in Fig.4B all eperiments were repeated at least nine times independently. The GLS-1(ef4) stimulation of tethered GLD-4 was performed three times.

Oocyte protein analysis: Remaining NP40 oocyte extracts were mixed with an equal volume of SDS sample buffer and boiled for 10 minutes (95 °C). Equivalents of one or half an oocyte were loaded onto an 8% SDS/PAGE gel and probed by immunoblotting with antibodies directed against HA or Myc epitopes, H17L10 and 9E10 respectively.

Supplemental references

Castresana, J. 2000. Selection of conserved blocks from multiple alignments for their use in phylogenetic analysis. Molecular Biology and Evolution 17: 540-552.

Crittenden, S.L. and Kimble, J. 1999. Confocal methods for Caenorhabditis elegans. Methods Mol Biol 122: 141-151.

Felsenstein, J. 1989. PHYLIP - Phylogeny Inference Package (Version 3.2). Cladistics 5: 164-166.

Huson, D.H., Richter, D.C., Rausch, C., Dezulian, T., Franz, M., and Rupp, R. 2007. Dendroscope: An interactive viewer for large phylogenetic trees. BMC Bioinformatics 8: 460.

Jones, A.R., Francis, R., and Schedl, T. 1996. GLD-1, a cytoplasmic protein essential for oocyte differentiation, shows stage- and sex-specific expression during Caenorhabditis elegans germline development. Dev Biol 180(1): 165-183.

Katoh, K., Misawa, K., Kuma, K., and Miyata, T. 2002. MAFFT: a novel method for rapid multiple sequence alignment based on fast Fourier transform. Nucleic Acids Res 30(14): 3059-3066.

Kawasaki, I., Shim, Y.H., Kirchner, J., Kaminker, J., Wood, W.B., and Strome, S. 1998. PGL-1, a predicted RNA-binding component of germ granules, is essential for fertility in C. elegans. Cell 94(5): 635-645.

Kwak, J.E., Wang, L., Ballantyne, S., Kimble, J., and Wickens, M. 2004. Mammalian GLD-2 homologs are poly(A) polymerases. Proc Natl Acad Sci U S A 101(13): 4407-4412.

LaCava, J., Houseley, J., Saveanu, C., Petfalski, E., Thompson, E., Jacquier, A., and Tollervey, D. 2005. RNA degradation by the exosome is promoted by a nuclear polyadenylation complex. Cell 121(5): 713-724.

Lee, M.H. and Schedl, T. 2006. RNA in situ hybridization of dissected gonads. WormBook: 1-7.

Nakamura, R., Takeuchi, R., Takata, K., Shimanouchi, K., Abe, Y., Kanai, Y., Ruike, T., Ihara, A., and Sakaguchi, K. 2008. TRF4 is involved in polyadenylation of snRNAs in Drosophila melanogaster. Mol Cell Biol 28(21): 6620-6631.

Nakanishi, T., Kubota, H., Ishibashi, N., Kumagai, S., Watanabe, H., Yamashita, M., Kashiwabara, S., Miyado, K., and Baba, T. 2006. Possible role of mouse poly(A) polymerase mGLD-2 during oocyte maturation. Dev Biol 289(1): 115-126.

Peculis, B.A. and Gall, J.G. 1992. Localization of the nucleolar protein NO38 in amphibian oocytes. J Cell Biol 116(1): 1-14.

Schäffer, A.A., Aravind, L., Madden, T.L., Shavirin, S., Spouge, J.L., Wolf, Y.I., Koonin, E.V., and Altschul, S.F. 2001. Improving the accuracy of PSI-BLAST protein database searches with composition-based statistics and other refinements. Nucleic Acids Res 29(14): 2994-3005.

Zetka, M.C., Kawasaki, I., Strome, S., and Muller, F. 1999. Synapsis and chiasma formation in Caenorhabditis elegans require HIM-3, a meiotic chromosome core component that functions in chromosome segregation. Genes Dev 13(17): 2258-2270.

Supplemental figure legends

Supplemental Figure 1: anti-GLD-4 antibodies and GLD-4 expression.

(A) GLD-4 is a germ line enriched protein (caret) and truncated or absent in gld-4 mutants (arrowheads). Protein extracts of adult hermaphrodites from given genotypes probed with a purified C-terminal and N-terminal GLD-4 antiserum; wt, wild-type; ef9 and ef15, are gld-4 mutations; no GL, glp-1(q224ts) animals without germ line; kDa, molecular weight marker.

(B) Full-length GLD-4 expressed in various systems migrates slower in SDS-PAGE gels. Epitope tagged GLD-4 ORFs were expressed in given expression systems. The molecular tag is indicated and the predicted molecular weight is given in brackets: RRL, rabbit reticulate lysate (104 kDa); yeast, S. cerevisiae (119 kDa), insect cells, SF+ (97 kDa), bacteria, E. coli JM109 (122 kDa). A smaller fragment of GLD-4 (5/6) served as a positive control.

(C) Epitope mapping of the monoclonal anti-GLD-4 antibody. A region between aa 420 and aa 525 is specifically recognized. To this end, indicated GST fusion fragments of GLD-4 were expressed in JM109 bacterial cells and the cell pellet was resuspended in 4M Urea/2%SDS Sample buffer. Extracts were separated on a 10% polyacylamide gel and immunoblotted with anti-GST and the monoclonal GLD-4 antibody.

Supplemental Figure 2: GLD-4 localizes to the cytosol in HeLa cells.

(A-C) Transfected HeLa cells expressing to low amounts HA-tagged fusion proteins stained with DAPI (A-C, A”-C”) and a monoclonal anti-HA antibody (A’-C’, A”-C”). The empty vector, encoding a HA-tagged MS2 protein, is found equally distributed inside the cell and GLD-4 is cytoplasmic. This is in contrast to nuclear yeast Trf4/5 (LaCava et al. 2005), and the proposed nucleolar localization of Drosophila TRF4-1 (Nakamura et al. 2008). As expected, hPAPD4/hGld2 is enriched in the nucleus as mouse GLD-2 is also nuclear (Nakanishi et al. 2006). A proposed nuclear localization signal sequence for hPAPD4, similar to mGLD-2, is depicted in Fig. 1B. (D) Schematic drawing of the plasmid encoding the fusion proteins under the control of a CMV promotor. MS2, RNA-binding domain of phage MS2 coat protein; 2xHA, tandem HA epitope tag.

Supplemental Figure 3: gld-1 mRNA abundance is compromised in gld-2 gld-4 mutant hermaphrodite germ lines.

(A-B) In situ hybridizations detect low gld-1 mRNA levels throughout the entire germ line in PAP double mutants compared to strong distal wild-type germlines. (C,D) colour images of very distal regions. To this end, germ lines were extruded from adult animals and processed as described (Lee and Schedl 2006). The antisense probe covering the entire coding region of gld-1 mRNA was generated by PCR and detected as described (Lee and Schedl 2006). The experiment was repeated three times and all gld-2 gld-4 double mutants germ lines were weakly stained, in comparison to the majority (>80%) of strongly stained wild-type germ lines.

................
................

In order to avoid copyright disputes, this page is only a partial summary.

Google Online Preview   Download