Molecular Biology – Final Laboratory Report



Jay Bradley

Molecular Biology

5/1/07

Gene Expression Profiling of the CFTR homolog, JAL1, and Localization of the Sirt1 homolog, LAJ2-GFP construct.

Abstract:

JAL1 is a Tetrahymena homolog of the human cAMP-regulated chloride channel, CFTR. Given that mutations in the CFTR gene are responsible for the cystic fibrosis phenotype, elucidation of the expression and involvement of equivalent proteins is important. In order to learn more about the function of JAL1 in Tetrahymena, gene expression profiling by RT-PCR was used to uncover its expression at different stages of the Tetrahymena life cycle. Results indicate that JAL1 may be important in meiosis and macronuclear differentiation during Tetrahymena conjugation, although the mechanism of involvement is unclear. Additionally, GFP-tagging and localization studies were performed on LAJ2, a Tetrahymena homolog of the human NAD-independent deacetylase, Sirt1. Results indicate that the functions of LAJ2 in Tetrahymena, including deacetylation involved in chromatin silencing, and downregulation of p53 activity may be similar to the activities of Sirt1 in human cells.

Introduction:

Cystic fibrosis (CF) is a hereditary disease affecting approximately 1 in 2500 children born worldwide. It is particularly prevalent among Europeans, with one in twenty-two people of European descent carrying one copy of the gene for CF. CF is caused by mutation in the cystic fibrosis transmembrane conductance regulator (CFTR) gene, which encodes a cAMP-regulated chloride channel. CFTR is composed of two symmetric halves, each with a membrane-spanning domain, and a nucleotide-binding domain which has ATP hydrolytic capacity (Figure 1). The two halves are connected by a fifth domain which helps regulate CFTR gating (Sheppard and Welsh, 1999).

[pic]

Figure 1: Representation of proposed CFTR structure

More than 1000 different mutations in this gene have been characterized in cystic fibrosis (Cystic Fibrosis Genetic Mutations Data Base). In order to function properly, newly synthesized CFTR must undergo conformational maturation at the endoplasmic reticulum. The most common mutations disrupt interactions between the domains, which halts posttranslational folding at the ER, and leads to eventual degradation of the polypeptide (Du et al., 2005). Absence of mature CFTR in the cell membrane impairs chloride conduction in several ways. In addition to itself transporting chloride out of the cell, CFTR is known to interact with Na+-reabsorptive pathways (Johnson et al., 1995), and to regulate outwardly rectifying chloride channels (ORCC’s) through the transport and release of ATP (Schwiebert et al., 1995). Nonetheless, although the primary defect in cystic fibrosis is impaired chloride conduction, the greatest health risk to individuals with cystic fibrosis is chronic lung infection and inflammation. There are two different theories concerning the role of chloride conduction in increased risk of lung infection. First it has been suggested that the defective chloride transport causes a decrease in salt content of the airway surface liquid (ASL) of the lungs, which inactivates salt-sensitive antimicrobial peptides. A second hypothesis proposes that decreased chloride conductance and increased sodium uptake (due to interactions of CFTR with the epithelial sodium channel) lead to a decrease in ASL volume, which in turn impairs mucociliary clearance (Perez et al., 2006). Mucus builds up and forms thickened plaques which serve as the nidus for bacterial infection (Boucher, 2004).

Due to the potential importance of cilia activity in prevention of mucus accumulation and subsequent bacterial infection associated with CF, studies with Tetrahymena, a ciliated protozoan, may prove invaluable in elucidating the specific function of normal CFTR protein. A Tetrahymena gene with high sequence homology with the human CFTR gene was discovered (TTHERM 00683350; E-value: 2.9x10-109), and named JAL1. A gene expression profile for this gene was determined, however despite several attempts to clone this gene into a plasmid for GFP tagging and Tetrahymena transformation, no insertions were successful. A Tetrahymena homolog of the human Sirt1 gene was adopted (TTHERM_00526990; E-value: 1.8x10-40), and used for GFP localization studies. This homolog will be referred to as LAJ2. Sirt1 is a conserved NAD-dependent deacetylase that has been implicated in chromatin silencing (Cheng et al., 2003), and downregulation of p53 and FoxO apoptosis pathways (Ford et al., 2005). An analysis of the localization of the LAJ2 protein through GFP tagging could provide further insight into the function of Sirt1, such as the location of interaction with p53 or FoxO in the attenuation of those pathways.

In this study, gene expression profiling through the use of RT-PCR was performed for the JAL1 gene, and GFP tagging and protein localization were performed for the LAJ2 gene. The JAL1 gene was found to be expressed at low levels 4 hours after conjugation, and at higher levels 8 hours after conjugation. This may suggest that the JAL1 gene product is important for processes such as meiosis, and macronuclear differentiaion, which occur at these time points. The LAJ2-GFP construct was found to be expressed throughout the cytoplasm, and at lower levels within the macronucleus. This appears to correlate with the known activities of the Sirt1 protein product, and likely indicates that the function of LAJ2 in Tetrahymena is similar to the function of Sirt1 in human cells.

Materials and Methods

RT-PCR

For gene expression profiling, RT-PCR analysis was used to determine the transcription level of the JAL1 gene at various stages of the Tetrahymena life cycle: Vegetative, Starved, 2 hours, 4 hours, 6 hours, 8 hours, 10 hours, and 12 hours post-starvation. RNA was harvested from Tetrahymena cells using Trizol reagent (Invitrogen) according to the manufacturer’s protocol. This was performed for the two hour time point after growing Tetrahymena were starved. The amount of RNA isolated was quantified by measuring the absorbance at 260 nm. cDNA was synthesized from the mRNA sample by PCR with oligo-dT primers and Superscript II reverse transcriptase. Samples were treated with RNase to get rid of the mRNA strands, leaving single stranded cDNA. cDNA from different time points of the Tetrahymena life cycle was used in PCR with primers for the JAL1 gene (Forward: 5’ - GTGCCGTGTTAGACTTTTG – 3’, Reverse: 5’ – GCCATTGAAATTTCGTCAC – 3’), and Phusion polymerase (from Sharon Torigoe, JSD), at an annealing temperature of 56.2 oC. PCR product was stained with ethidium bromide and analyzed by gel electrophoresis on a 1% agarose gel.

GFP localization

Tetrahymena genomic DNA was purified using a phenol extraction. The amount of DNA isolated was quantified by measuring the absorbance at 260 nm. PCR amplification of the LAJ2 gene was performed with Tetrahymena genomic DNA or cDNA, Phusion polymerase (from Sharon Torigoe, JSD), and primers for the LAJ2 gene (Forward: 5’ – CACCATGAGTTCTGAAATTAGTAAACC – 3’; Reverse: 5’ – TCAAAGGTTTAATTTCTTCTCT – 3’). Annealing temperatures of 56 oC and 59oC were used. PCR product was analyzed by gel electrophoresis, then amplified cDNA was extracted from the gel and cloned into the pENTR/D-TOPO plasmid (Figure 2). Escherichia coli cells were heat-shocked and transformed with the LAJ2- pENTR/D-TOPO plasmid. PCR amplification of the insert-containing region of the plasmid was used to determine which bacteria cultures had integrated plasmid into which LAJ2 had successfully been cloned. Restriction digest with Not1 restriction enzyme and subsequent gel electrophoresis further verified that the LAJ2 gene successfully integrated into the pENTR/D-TOPO plasmid. LR Clonase II enzyme was used to recombine the LAJ2 coding sequence into the pIGF-GTW plasmid (Figure 3). The pIGF-GTW plasmid was purified by the boiling method, and analyzed by BamHI digest, gel electrophoresis, and Southern blot to verify that the LAJ2 gene was successfully integrated. Additionally, the insert was sequenced and the sequence compared against the Tetrahymena Genome Database. Tetrahymena were electroporated and transformed with the Sirt-1-containing pIGF-GTW vector. Transformants were selected with paromycin. Succcessful transformants were treated with CdCl2 (1.5 µg/mL) to induce the MTT promoter, and DAPI to stain DNA, and then visualized using fluorescence microscopy (Figure 4).

[pic]

Figure 2: Schematic of pENTR/D-TOPO plasmid

[pic]

Figure 3: Scehmatic of pIGF-GTW plasmid (pmr-rRNA= paramomycin resistance gene).

Results

Gene Expression Profile

Gel electrophoresis was performed on EtBr-stained samples from RT-PCR with JAL1 primers in order to determine the stages of the Tetrahymena life cycle during which the JAL1 gene is actively transcribed. Transcription levels at various time points provide strong indication of the processes in which the protein product is involved. Gene transcription is quantified by the intensity of bands in the gel. The more mRNA that is present at a given time point, the more cDNA that will be produced and amplified by PCR. Results indicated that JAL1 is not expressed until four hours after conjugation. At four hours post-conjugation JAL1 is expressed at low levels. JAL1 transcription is halted until eight hours post-conjugation, at which point it is transcribed at higher levels (Figure 4A). Primers used for JAL1 gene were expected to amplify a 402 bp region of DNA. Comparison with the 500 bp band of the 1 kb ladder indicates that this is approximately the size of the amplified region of DNA obtained through PCR. As a loading control, RT-PCR was performed with HHP1 primers. HHP1 is known to be strongly expressed at all stages of the Tetrahymena life cycle. These results demonstrated that equal amounts of cDNA were used for each PCR reaction, as the amount of resulting DNA was the same for all lanes (Figure 4B).

[pic]

Figure 4: Gel electrophoresis of cDNA from RT-PCR of mRNA at different time points of Tetrahymena life cycle. (A) RT-PCR with JAL1 primers indicates that JAL1 is transcribed at low levels 4 hours after conjugation, and at higher levels 8 hours after conjugation. (B) RT-PCR with HHP1 primers reveals equal amounts of cDNA used for each PCR reaction. Gene expression normally decreases in starvation (S). V, vegetatively growing; S, starved; numbers indicate hours into conjugation (post-mixing). Band size is 420 bp from cDNA, 500 from genomic template.

GFP localization

Transformed cells were induced with CdCl2 and stained with DAPI, and then visualized by fluorescence microscopy. Because the LAJ2 gene is “tagged” by GFP, fluorescence microscopy will allow identification of locations in the cell where LAJ2 is expressed. Results indicated that LAJ2 was strongly expressed throughout the cytosol, and also expressed weakly in the macronucleus. Note that DAPI staining of the macronucleus was not detected due to a high level of DAPI background (Figure 5: A,B). Wild-type cells were used as a negative control. These cells could still be visualized through DAPI staining of the DNA, however no GFP expression was observed (Figure 5: C, D). As another control Tetrahymena transformed with the LAJ2-GFP construct, but not treated with CdCl2 to induce the MTT promoter were used. There was some low level GFP expression due to a “leaky” promoter, however GFP expression was substantially lower than in Tetrahymena induced with CdCl2 (Figure 5: G, H). The final positive control was the use of Tetrahymena that express GFP only, not the LAJ2-GFP construct. These Tetrahymena express GFP throughout the cytoplasm, but without any particular localization of the signal (Figure 5: E, F).

[pic]

Figure 5: Fluorescence microscopy images of cells treated with DAPI and then viewed under DAPI or GFP detection conditions. (A) DAPI staining of cell transformed with LAJ2-GFP/pIGF vector and induced with CdCl2. (B) Tetrahymena transformed with LAJ2-GFP/pIGF vector express GFP throughout the cytoplasm, but only weakly in the macronucleus. (C) DAPI staining of wild type Tetrahymena. (D) Wild type Tetrahymena express no GFP, and serve as a negative control. (E) DAPI staining of cell expressing only GFP, not the LAJ2-GFP construct. (F) Tetrahymena transformed only with GFP show random GFP expression throughout the cytoplasm, but no GFP expression in the macronucleus. (G) DAPI staining of cell transformed with LAJ2-GFP construct, but not induced with CdCl2. (H) Tetrahymena transformed with LAJ2-GFP, but not treated with CdCl2 to induce the MTT promoter show almost no GFP expression. Slight GFP signal is due to “leaky” promoter.

Discussion

The gene expression profile of the JAL1 gene indicated that JAL1 is transcribed at low levels 4 hours post-conjugation, and at higher levels 8 hours after conjugation. In order to identify possible processes which the product of the JAL1 gene is involved in, it is necessary to consider what was going on in the cells at 4 and 8 hours post-conjugation. At the 4 hour time point, Tetrahymena have paired, and the micronuclei of both cells are undergoing meiosis and nuclear fusion. Given that the JAL1 gene is expressed at this point, it is likely that it has some involvement in the process of micronuclear meiosis and fusion. If the product of the JAL1 gene may be assumed to have a similar structure and function to its human homolog, CFTR, then it may be possible that it is needed to maintain stable chloride concentrations inside the individual cells when the two Tetrahymena are conjugated.

At 8 hours post-conjugation, Tetrahymena are initiating macronuclear differentiation. This marks the start of transcriptional activity of the new macronuclei. Once again, the marked increase in JAL1 expression during this stage of the life cycle likely indicates that the protein product of the JAL1 gene is important for macronuclear differentiation and intiation of transcriptional activity. For both the 4 hour and 8 hour time points, the implication of JAL1 involvement in nuclear activities such as meiosis and transcriptional activation is somewhat surprising. Given the very high degree of homology between JAL1 and the human CFTR gene, it is very likely that the structure and function of the protein products of the two genes are similar. In human epithelial cells CFTR is a integral membrane protein responsible for chloride transport out of the cell. It has not been previously found to be involved in nuclear processes. This indicates that the specific function of the JAL1 protein product in Tetrahymena may be different than that of CFTR in human cells. It is also possible that JAL1 has some type of secondary involvement, such as the maintenance of stable and isotonic chloride concentrations while Tetrahymena cells are undergoing conjugation.

Results of the localization of LAJ2-GFP indicate that LAJ2 is highly expressed throughout the cytoplasm, and present in lower levels inside the macronucleus (Figure 5: B). This finding correlates closely with the expected function of LAJ2 based on homology with the human Sirt1 gene. Sirt1 is a NAD-independent deacetylase, which is known to be involved in chromatin silencing. Assuming a similar function for the protein product of the Sirt1 gene, this could likely explain the reason for LAJ2-GFP localization in the macronucleus. Sirt1 has also been implicated in down regulation of p53 activity DNA-binding activity (Ford et al., 2005). Furthermore, p53 has been shown to localize both in the cytoplasm and in the nucleus. Deacetylation of p53 in the cytoplasm could inactivate these proteins so that they do not enter the nucleus and bind DNA to intitiate p53-mediated apoptosis. This suggests the possibility that the presence of Sirt1, or in this case LAJ2, in the cytoplasm, accounts for some of its potential attenuation of p53 activity through deacetylation. It is not surprising therefore that LAJ2-GFP was seen to localize in the cytoplasm.

References

Boucher, R.C. 2004. New concepts of the pathogenesis of cystic fibrosis lung disease. European Respiratory Journal 23: 146-158.

Cheng, H., Mostoslavsky, R., Saito, S., Manis, J.P., Gu, Y., Patel, P., Bronson, R., Appella, E. Alt, F.W., Chua, K.F. 2003. Developmental defects and p53 hyperacetylation in Sir2 homolog (SIRT1)-deficient mice. PNAS 100(19): 10794-10795.

Du, K., Sharma, M., Lukacs, G.L. 2005. The ∆F508 cystic fibrosis mutation impairs domain-domain interactions and arrests post-translational folding of CFTR. Nature Structural and Molecular Biology 12(1): 17-25.

Ford J., Jiang, M., Milner, J. 2005. Cancer-specific functions of Sirt1 enable human epithelial cancer cell growth and survival. Cancer Research 65: 10457-10463.

Johnson, L.J., Boyles, S.E., Wilson, J., Boucher, R.C. 1995. Normalization of raised sodium absorption and raised calcium-mediated chloride secretion by adenovirus-mediated expression of CFTR in primary human cystic fibrosis airway epithelial cells. Journal of Clinical Investigation 95:1377-1382.

Perez, A., Issler, A.C., Cotton, C.U., Kelley, T.J., Verkman, A.S., Davis, P.B. 2006. CFTR inhibition mimics the cystic fibrosis inflammatory profile. American Journal of Physiology Lung Cell Molecular Physiology 292:383-395.

Ratjen , F., Döring, G. 2003. Cystic Fibrosis. The Lanctet 361: 681-689.

Schwiebert, E.M., Egan, M.E., Hwang, T., Fulmer, S.B., Allen, S.S., Cutting, G.R., Guggino, W.B. 1995. CFTR regulated outwardly rectifying chloride channels through an autocrine mechanism involving ATP. Cell 81: 1063-1073.

Sheppard, D., Welsh, M. 1999. Structure and function of the CFTR chloride channel. Physiology Reviews 79: S23-S45.

The Cystic Fibrosis Genetic Analysis Consortium. Cystic Fibrosis Mutation Data Base. (Accessed 4/28/07).

................
................

In order to avoid copyright disputes, this page is only a partial summary.

Google Online Preview   Download