Protein Synthesis Project - Weebly
Protein Synthesis Project
DNA Molecule Part: TACAAACATTTAGTTGTAAACACACCCTCAGTGGACCAACTCCGCAACATAAACCAAACACCGCTCGCGCCGAAAAAGATATGGGGGTTTTGG
Construct a chart using the following directions:
1. Decode the above strand of DNA. Write out the resulting m-RNA in the space below.
m-RNA ___________________________________________________________
__________________________________________________________________________
__________________________________________________________________________
__________________________________________________________________________
2. Divide the m-RNA into its codons by placing a vertical line between them.
3. Using the amino acid chart found in your textbook, determine the name of the amino acid that each codon codes for. Write the abbreviation of the amino acids in their proper order, in the space below. ___________________________________________________________
__________________________________________________________________________
__________________________________________________________________________
__________________________________________________________________________
4. After examining the polypeptide chain just constructed, determine if it is a beginning, a middle, or an end segment of the pro insulin molecule.
Circle the appropriate term denoting your segment.
5. Find two (2) other segments among your classmates that will complete the protein. If you have a middle segment you will need to find a beginning and an end segment........etc.
6. Record the entire list of amino acids on a separate sheet of paper. Start with the beginning segment, followed by the middle, and ending with tail.
7. Name the enzymes needed for the following processes to occur.
a. t-RNA activation _________________________________________________
b. termination of protein synthesis (what binds to the stop codon?) ______________________________________
c. mRNA Start-up
_____________________________________________________
9. Explain how the proper amino acid is attached to their correct t-RNA molecule.
________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________
10. How many amino acids does this complete protein contain? _____________
11. How many molecules of water are lost in the process of creating this entire protein? ____________.
12. This protein is called pro-insulin. In order for it to operate in the body, a segment between #30 and #66 amino acids must be removed. The remaining sections are reconnected to form insulin. How many amino acids are there in the protein insulin? ____________.
Protein Synthesis Project
DNA Molecule Part: TCTTCCCTCGCGCTCCTAAACGTTCAACCGGTTCAACTTAAT
CCGCCGCCAGGGCCCCGCCCCTCAGAAGTTGGTGATGCG
Construct a chart using the following directions:
1. Decode the above strand of DNA. Write out the resulting m-RNA in the space below.
m-RNA ___________________________________________________________
__________________________________________________________________________
__________________________________________________________________________
__________________________________________________________________________
2. Divide the m-RNA into its codons by placing a vertical line between them.
3. Using the amino acid chart found in your textbook, determine the name of the amino acid that each codon codes for. Write the abbreviation of the amino acids in their proper order, in the space below. ___________________________________________________________
__________________________________________________________________________
__________________________________________________________________________
__________________________________________________________________________
4. After examining the polypeptide chain just constructed, determine if it is a beginning, a middle, or an end segment of the pro insulin molecule.
Circle the appropriate term denoting your segment.
5. Find two (2) other segments among your classmates that will complete the protein. If you have a middle segment you will need to find a beginning and an end segment........etc.
6. Record the entire list of amino acids on a separate sheet of paper. Start with the beginning segment, followed by the middle, and ending with tail.
7. Name the enzymes needed for the following processes to occur.
d. t-RNA activation _________________________________________________
e. termination of protein synthesis (what binds to the stop codon?) ______________________________________
f. mRNA Start-up
_____________________________________________________
8. Explain how the proper amino acid is attached to their correct t-RNA molecule.
________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________
13. How many amino acids does this complete protein contain? _____________
14. How many molecules of water are lost in the process of creating this entire protein? ____________.
15. This protein is called pro-insulin. In order for it to operate in the body, a segment between #30 and #66 amino acids must be removed. The remaining sections are reconnected to form insulin. How many amino acids are there in the protein insulin? ____________.
Protein Synthesis Project
DNA Molecule Part: AATCTCCCATCAGACGTTTTTGCCCCGTAACAACTTGTTACAACA
TGGTCATAAACGTCAGAGATGGTCAATCTCTTAATGACGTTAACT
Construct a chart using the following directions:
1. Decode the above strand of DNA. Write out the resulting m-RNA in the space below.
m-RNA ___________________________________________________________
__________________________________________________________________________
__________________________________________________________________________
__________________________________________________________________________
2. Divide the m-RNA into its codons by placing a vertical line between them.
3. Using the amino acid chart found in your textbook, determine the name of the amino acid that each codon codes for. Write the abbreviation of the amino acids in their proper order, in the space below. ___________________________________________________________
__________________________________________________________________________
__________________________________________________________________________
__________________________________________________________________________
4. After examining the polypeptide chain just constructed, determine if it is a beginning, a middle, or an end segment of the pro insulin molecule.
Circle the appropriate term denoting your segment.
5. Find two (2) other segments among your classmates that will complete the protein. If you have a middle segment you will need to find a beginning and an end segment........etc.
6. Record the entire list of amino acids on a separate sheet of paper. Start with the beginning segment, followed by the middle, and ending with tail.
7. Name the enzymes needed for the following processes to occur.
a. t-RNA activation _________________________________________________
b. termination of protein synthesis (what binds to the stop codon?) ______________________________________
c. mRNA Start-up
_____________________________________________________
9. Explain how the proper amino acid is attached to their correct t-RNA molecule.
______________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________
10. How many amino acids does this complete protein contain? _____________
11. How many molecules of water are lost in the process of creating this entire protein? ____________.
12. This protein is called pro-insulin. In order for it to operate in the body, a segment between #30 and #66 amino acids must be removed. The remaining sections are reconnected to form insulin. How many amino acids are there in the protein insulin? ____________.
[pic]
C738H1166N812O203S2Fe = Hemoglobin
C256H381N65079S6 = Insulin
................
................
In order to avoid copyright disputes, this page is only a partial summary.
To fulfill the demand for quickly locating and searching documents.
It is intelligent file search solution for home and business.
Related searches
- bioman biology protein synthesis game
- bioman bio protein synthesis race
- protein synthesis process
- protein synthesis race bioman biology
- protein synthesis race game
- protein synthesis race
- protein synthesis video
- bioman protein synthesis worksheet
- protein synthesis animation video
- protein synthesis board game
- protein synthesis card game
- protein synthesis khan academy