DNA Fingerprinting: Catching Criminals by ... - Science A 2 Z



DNA Fingerprinting: Catching Criminals by Jessica Martell

Also crediting the following websites:







Goals:

➢ Students will reinforce their understanding of DNA.

➢ Students learn about DNA Fingerprinting.

➢ Students will work in groups to solve the mystery of the in class activity on DNA Fingerprinting.

Background Information:

Provided by: &

Deoxyribonucleic acid (DNA) is a nucleic acid that contains the genetic instructions used in the development and functioning of all known living organisms and some viruses. The main role of DNA molecules is the long-term storage of information. DNA is often compared to a set of blueprints or a recipe, or a code, since it contains the instructions needed to construct other components of cells, such as proteins and RNA molecules. The DNA segments that carry this genetic information are called genes, but other DNA sequences have structural purposes, or are involved in regulating the use of this genetic information.

Chemically, DNA consists of two long polymers of simple units called nucleotides, with backbones made of sugars and phosphate groups joined by ester bonds. These two strands run in opposite directions to each other and are therefore anti-parallel. Attached to each sugar is one of four types of molecules called bases. It is the sequence of these four bases along the backbone that encodes information. This information is read using the genetic code, which specifies the sequence of the amino acids within proteins. The code is read by copying stretches of DNA into the related nucleic acid RNA, in a process called transcription.

Within cells, DNA is organized into structures called chromosomes. These chromosomes are duplicated before cells divide, in a process called DNA replication. Eukaryotic organisms (animals, plants, fungi, and protists) store their DNA inside the cell nucleus, while in prokaryotes (bacteria and archae) it is found in the cell's cytoplasm. Within the chromosomes, chromatin proteins such as histones compact and organize DNA. These compact structures guide the interactions between DNA and other proteins, helping control which parts of the DNA are transcribed.

Base pairing

Each type of base on one strand forms a bond with just one type of base on the other strand. This is called complementary base pairing. Here, purines form hydrogen bonds to pyrimidines, with A bonding only to T, and C bonding only to G. This arrangement of two nucleotides binding together across the double helix is called a base pair. As hydrogen bonds are not covalent, they can be broken and rejoined relatively easily. The two strands of DNA in a double helix can therefore be pulled apart like a zipper, either by a mechanical force or high temperature.[12] As a result of this complementarity, all the information in the double-stranded sequence of a DNA helix is duplicated on each strand, which is vital in DNA replication. Indeed, this reversible and specific interaction between complementary base pairs is critical for all the functions of DNA in living organisms.[1]

The two types of base pairs form different numbers of hydrogen bonds, AT forming two hydrogen bonds, and GC forming three hydrogen bonds (see figures, left). DNA with high GC-content is more stable than DNA with low GC-content, but contrary to popular belief, this is not due to the extra hydrogen bond of a GC base pair but rather the contribution of stacking interactions (hydrogen bonding merely provides specificity of the pairing, not stability).[13] As a result, it is both the percentage of GC base pairs and the overall length of a DNA double helix that determine the strength of the association between the two strands of DNA. Long DNA helices with a high GC content have stronger-interacting strands, while short helices with high AT content have weaker-interacting strands.[14] In biology, parts of the DNA double helix that need to separate easily, such as the TATAAT Pribnow box in some promoters tend to have a high AT content, making the strands easier to pull apart.[15] In the laboratory, the strength of this interaction can be measured by finding the temperature required to break the hydrogen bonds, their melting temperature (also called Tm value). When all the base pairs in a DNA double helix melt, the strands separate and exist in solution as two entirely independent molecules. These single-stranded DNA molecules have no single common shape, but some conformations are more stable than others.[16]

DNA profiling (also called DNA testing, DNA typing, or genetic fingerprinting) is a technique employed by forensic scientists to assist in the identification of individuals on the basis of their respective DNA profiles.

Although 99.9% of human DNA sequences are the same in every person, enough of the DNA is different to distinguish one individual from another. DNA profiling uses repetitive ("repeat") sequences that vary a lot, called variable number tande repeats (VNTR). VNTRs loci are very similar between closely related humans, but so variable that unrelated individuals are extremely unlikely to have the same VNTRs.

The DNA profiling technique was first reported in 1985 by Sir Alec Jeffreys at the University of Leicester in England,[1] and is now the basis of several national DNA databases.

DNA profiling process

Genetics with the extraction of an individual's DNA (typically called a "reference sample"). The most desirable method of collecting a reference sample is the use of a buccal swab, as this reduces the possibility of contamination. When this is not available (eg because a court order may be needed and not obtainable) other methods may need to be used to collect a sample of blood, saliva, semen, or other appropriate fluid or tissue from personal items (e.g. toothbrush, razor, etc) or from stored samples (e.g. banked sperm or biopsy tissue). Samples obtained from blood relatives (biological relative) can provide an indication of an individual's profile, as could human remains which had been previously profiled.

A reference sample is then analyzed to create the individual's DNA profile using one of a number of techniques, discussed below. The DNA profile is then compared against another sample to determine whether there is a genetic match.

RFLP analysis

The first methods for finding out genetics used for DNA profiling involved restriction enzyme digestion, followed by Southern blot analysis. Although polymorphisms can exist in the restriction enzyme cleavage sites, more commonly the enzymes and DNA probes were used to analyze VNTR loci. However, the Southern blot technique is laborious, and requires large amounts of undegraded sample DNA. Also, Karl Brown's original technique looked at many minisatellite loci at the same time, increasing the observed variability, but making it hard to discern individual alleles (and thereby precluding parental testing). These early techniques have been supplanted by PCR-based assays.

PCR analysis

With the invention of the polymerase chain reaction (PCR) technique, DNA profiling took huge strides forward in both discriminating power and the ability to recover information from very small (or degraded) starting samples. PCR greatly amplifies the amounts of a specific region of DNA, using oligo nucleotide primers and a thermostable DNA polymerase. Early assays such as the HLA-DQ alpha reverse dot blot strips grew to be very popular due to their ease of use, and the speed with which a result could be obtained. However they were not as discriminating as RFLP. It was also difficult to determine a DNA profile for mixed samples, such as a vaginal swab from a sexual assault victim.

Fortunately, the PCR method is readily adaptable for analyzing VNTR loci. In the United States the FBI has standardized a set of 13 VNTR assays for DNA typing, and has organized the CODIS database for forensic identification in criminal cases. Similar assays and databases have been set up in other countries. Also, commercial kits are available that analyze single nucleotide polymorphisms (SNPs). These kits use PCR to amplify specific regions with known variations and hybridize them to probes anchored on cards, which results in a colored spot corresponding to the particular sequence variation.

STR analysis

The method of DNA profiling used today is based on PCR and uses short tandem repeats (STR). This method uses highly polymorphic regions that have short repeated sequences of DNA (the most common is 4 bases repeated, but there are other lengths in use, including 3 and 5 bases). Because different unrelated people have different numbers of repeat units, these regions of DNA can be used to discriminate between unrelated individuals. These STR loci (locations) are targeted with sequence-specific primers and are amplified using PCR. The DNA fragments that result are then separated and detected using electrophoresis. There are two common methods of separation and detection, capillary electrophoresis (CE) and gel electrophoresis.

The polymorphisms displayed at each STR region are by themselves very common, typically each polymorphism will be shared by around 5 - 20% of individuals. When looking at multiple loci, it is the unique combination of these polymorphisms to an individual that makes this method discriminating as an identification tool. The more STR regions that are tested in an individual the more discriminating the test becomes.

From country to country, different STR-based DNA-profiling systems are in use. In North America systems which amplify the CODIS 13 core loci are almost universal, while in the UK the SGM+ system, which is compatible with The National DNA Database in use. Whichever system is used, many of the STR regions under test are the same. These DNA-profiling systems are based around multiplex reactions, whereby many STR regions will be under test at the same time.

Capillary electrophoresis works by electro kinetically (movement through the application of an electric field) injecting the DNA fragments into a thin glass tube (the capillary) filled with polymer. The DNA is pulled through the tube by the application of an electric field, separating the fragments such that the smaller fragments travel faster through the capillary. The fragments are then detected using fluorescent dyes that were attached to the primers used in PCR. This allows multiple fragments to be amplified and run simultaneously, a procedure known as multiplexing. Sizes are assigned using labeled DNA size standards that are added to each sample, and the number of repeats are determined by comparing the size to an allelic ladder, a sample that contains all of the common possible repeat sizes. Although this method is expensive, larger capacity machines with higher throughput are being used to lower the cost/sample and reduce backlogs that exist in many government crime facilities.

Gel electrophoresis acts using similar principles as CE, but instead of using a capillary, a large polyacrylamide gel is used to separate the DNA fragments. An electric field is applied, as in CE, but instead of running all of the samples by a detector, the smallest fragments are run close to the bottom of the gel and the entire gel is scanned into a computer. This produces an image showing all of the bands corresponding to different repeat sizes and the allelic ladder. This approach does not require the use of size standards, since the allelic ladder is run alongside the samples and serves this purpose. Visualization can either be through the use of fluorescently tagged dyes in the primers or by silver staining the gel prior to scanning. Although it is cost-effective and can be rather high throughput, silver staining kits for STRs are being discontinued. In addition, many labs are phasing out gels in favor of CE as the cost of machines becomes more manageable.

The true power of STR analysis is in its statistical power of discrimination. In the US, there are 13 core loci (DNA locations) that are currently used for discrimination in CODIS. Because these loci are independently assorted (having a certain number of repeats at one locus doesn't change the likelihood of having any number of repeats at any other locus), the product rule for probabilities can be applied. This means that if someone has the DNA type of ABC, where the three loci were independent, we can say that the probability of having that DNA type is the probability of having type A times the probability of having type B times the probability of having type C. This has resulted in the ability to generate match probabilities of 1 in a quintillion (1 with 18 zeros after it) or more. However, since there are about 12 million monozygotic twins on Earth, that theoretical probability is useless. For example, the actual probability that 2 random persons have the same DNA is only 1 in 3 trillion.

DNA data bases

There are now several DNA databases in existence around the world. Some are private, but most of the largest databases are government controlled. The United States maintains the largest DNA database, with the Combined DNA Index System, holding over 5 million records as of 2007[2]. The United Kingdom maintains the National DNA Database (NDNAD), which is of similar size. The size of this database, and its rate of growth, is giving concern to civil liberties groups in the UK, where police have wide-ranging powers to take samples and retain them even in the event of acquittal.[3]

The U.S. Patriot Act of the United States provides a means for the U.S. government to get DNA samples from other countries if they are either a division of, or head office of, a company operating in the U.S. Under the act, the American offices of the company can't divulge to their subsidiaries/offices in other countries the reasons that these DNA samples are sought or by whom.

When a match is made from a National DNA Databank to link a crime scene to an offender who has provided a DNA Sample to a databank that link is often referred to as a cold hit. A cold hit is of value in referring the police agency to a specific suspect but is of less evidential value than a DNA match made from outside the DNA Databank.[4].

Evidence of genetic relationship

It's also possible to use DNA profiling as evidence of genetic relationship, but testing that shows no relationship isn't absolutely certain. While almost all individuals have a single and distinct set of genes, rare individuals, known as "chimeras", have at least two different sets of genes. There have been several cases of DNA profiling that falsely "proved" that a mother was unrelated to her children.[7]

Benchmark(s) Addressed:

Grade 6:

➢ 6.1 Structure and Function: Living and non-living systems are organized groups of related parts that function together and have characteristic properties.

➢ 6.1. LS.1. Describe the function and relative complexity of cells, tissues, organs, and organ systems in organisms and explain that different body tissues and organs are made up of different kinds of cells. Explain that the way in which cells function is similar in all living organisms and compare and contrast the types and components of cells.

➢ 6.2 Interaction and Change: The related parts within a system interact and change.

➢ 6.2. LS.1 Describe the interactions between and among cells, tissues, organs and organ systems.

➢ 6.3 Scientific Inquiry: Scientific inquiry is the investigation of the natural world based on observation and prior science knowledge. The investigation includes proposing hypotheses, developing the procedures for questioning, collecting, analyzing, and interpreting accurate and relevant data to produce justifiable evidence-based explanations.

➢ 6.3.1. Based on observation, and scientific concepts and knowledge, propose hypotheses that can be examined through scientific investigation. Design and conduct an investigation that uses appropriate tools and techniques to collect relevant data.

➢ 6.3.2 Organize and display relevant data, construct an evidence-based explanation of the results of an investigation, and communicate the conclusions.

➢ 6.3.3 Explain why if more than one variable changes at the same time in an investigation, the outcome of the investigation may not be clearly attributable to any one variable.

Grade 7:

➢ 7.1 Structure and Function: Living and non-living systems are composed of component parts which are responsible for the defining characteristics and traits of the system.

➢ 7.1. LS.2 Distinguish between inherited and learned traits, explain how inherited traits are passed from generation to generation, and describe the relationships among phenotype, genotype, chromosomes, and genes.

➢ 7.3 Scientific Inquiry: Scientific inquiry is the investigation of the natural world based on observation and prior science knowledge. The investigation includes proposing hypotheses, designing the procedures for questioning, collecting, analyzing, and interpreting multiple forms of accurate and relevant data to produce justifiable evidence-based explanations.

➢ 7.3.1. Based on observations, and scientific concepts and knowledge, propose hypotheses that can be examined through scientific investigation. Design and conduct a scientific investigation that uses appropriate tools and techniques to collect relevant data.

➢ 7.3.2 Organize, display, and analyze relevant data, construct an evidence-based explanation of the results of an investigation, and communicate the conclusions including possible sources of error.

➢ 7.3.3 Evaluate the validity of claims, based on the amount and quality of the evidence cited.

Grade 8:

➢ 8.1 Structure and Function: Systems function through interactions of component parts via mechanisms with various levels of complexity.

➢ 8.1. LS.1 Explain how organisms from both the past and the present are classified based on their genetics and their internal and external structures. Describe how scientists use classification systems to show relationships among organisms.

➢ 8.2. LS.3 Explain how organelles within a cell perform cellular processes and how cells obtain the raw materials for those processes.

➢ 8.3 Scientific Inquiry: Scientific inquiry is the investigation of the natural world through observations and prior science knowledge. The investigation includes proposing hypotheses, designing procedures for questioning, collecting, analyzing, and interpreting multiple forms of accurate and relevant data to produce justifiable evidence-based explanations and new explorations.

➢ 8.3.1. Based on observations, and scientific concepts and knowledge, propose hypotheses that can be examined through scientific investigation. Design and conduct a scientific investigation that uses appropriate tools, techniques, independent and dependent variables and controls to collect relevant data.

➢ 8.3.2 Organize, display, and analyze relevant data, construct an evidence-based explanation of the results of a scientific investigation, and communicate the conclusions including possible sources of error. Suggest new investigations based on analysis of results.

➢ 8.3.3 Explain how scientific explanations and theories evolve as new information becomes available.

Materials and Costs:

List the supplies and equipment needed for initial set up.

➢ PowerPoint program, computer and projector $ 0

(Available through school district)

➢ Scissor ($1..69 pack of 2 x 15) $25.35

➢ Copy of the “Final Report” per student $ 0

(School copier)

➢ Copy of the ”DNA Evidence Evaluation” per group $ 0

(School copier)

Estimated total, one-time, start-up cost $25.35

List the consumable supplies and estimated cost for presenting to a class of 30 students

➢ Copy of the “Final Report” per student $0

(School copier)

➢ Copy of the ”DNA Evidence Evaluation” per group $0

(School copier)

Estimated total cost each year $0

Time:

Initial prep time: 60-120 minutes

Preparation time: 20 minutes

Instruction time: 60 minutes for presentation, 60-90 minutes for activity

Clean-up time: 15 minutes

Assessment:

➢ Each student should have filled out their own “Final Report.” Have every student turn this in for you to evaluate their understanding.

➢ Have a class discussion about the activity once it is over, so students can not only share their views, but you can asses the class overall on their understanding of the material that was presented.

➢ The older the student the more detail you can require:

( Have each student write a reflection page(s) about what they learned from this lesson/activity. (What you require could be dependant on age.)

( EX: 6th grade… general overview with a few key points.

( EX: 7th grade… “…” with more key points and what they learned and found interesting in this lab activity.

( EX: 8th grade… “…” and now have the students write about how this is relevant in the real world.

CITY POLICE DEPARTMENT

FINAL REPORT

Identify the members of your Forensic Team:

Were there any suspects’ DNA found at the crime scene? If so, who?

After processing the evidence, explain how your group made their conclusion.

DNA EVIDENCE EVALUATION

WORK ONLY ON YOUR DNA SAMPLE

1. Each team member should have one DNA sequence strip. Use your scissors (restriction enzymes) to cut your DNA samples only where you see this base pattern: Cut between the C and G as shown in this example:

|CCGG |

|GGCC |

| CUT CUT |

|TACC l GGTAATTCATCC l GGTCAATTCTAGCGTAC |

|ATGG l CCATTAAGTAGG l CCAGTTAAGATCGCATG |

|GGTCAATTCTAGCGTAC |

|CCAGTTAAGATCGCATG |

|GGTAATTCATCC |

|CCATTAAGTAGG |

|TACC |

|ATGG |

Keep all the DNA fragments you cut from one sample together.

Do not mix up with other sample fragments.

2. Count the number of base pairs (bp) in each fragment of DNA that you have cut. A base pair consists of two complementary bases.

3. Record the number of base pairs in each piece on the backside of the DNA fragment.

1 2 3 4 5 6 7 8 9 10 11 12

|G C T A A T T C A T C C |

|C G A T T A A G T A G G |

|12 base pairs |

Base side Backside

4. Tape your DNA sequences on the chart according to the number of base pairs.

5. Be sure to put all the fragments from your sample in the proper column.

6. Analyze the DNA fragments.

7. Look at the number of fragments and sizes for all suspect and crime scene samples.

8. Are there any suspects that match the crime scene DNA?

9. Begin to fill out the Final Report sheet with your conclusions.

|Crime DNA |SUSPECT 1 |SUSPECT 2 |SUSPECT 3 |SUSPECT 4 |# of Base Pairs (bp) |

| | | | | |34 |

| | | | | |33 |

| | | | | |32 |

| | | | | |31 |

| | | | | |30 |

| | | | | |29 |

| | | | | |28 |

| | | | | |27 |

| | | | | |26 |

| | | | | |27 |

| | | | | |25 |

| | | | | |24 |

| | | | | |23 |

| | | | | |22 |

| | | | | |21 |

| | | | | |20 |

| | | | | |19 |

| | | | | |18 |

| | | | | |17 |

| | | | | |16 |

| | | | | |15 |

| | | | | |14 |

| | | | | |13 |

| | | | |12 bp |12 |

| | | | | |11 |

| | | | | |10 |

| | | | | |9 |

| | | | | |8 |

| | | | | |7 |

| | | | | |6 |

| | | | | |5 |

| | | | | |4 |

| | | | | |3 |

| | | | | |2 |

| | | | | |1 |

Crime DNA Crime DNA Crime DNA Crime DNA Crime DNA Crime DNA

GTCGACCGGTGACCGTGCGTACACAGTGCTCCGGATAGCTGATAGCTCCGGTG

CAGCTGGCCACTGGCACGCATGTGTCACGAGGCCTATCGACTATCGAGGCCAC

Suspect 1 DNA Suspect 1 DNA Suspect 1 DNA Suspect 1 DNA Suspect

GTCCCAGCCGGACCGTACCGGTAGATCAGCCGGTAGATTGATAGCGTGATGTG

CAGGGTCGGCCTGGCATGGCCATCTAGTCGGCCATCTAACTATCGCACTACAC

Suspect 2 DNA Suspect 2 DNA Suspect 2 DNA Suspect 2 DNA Suspect

GTCTACGTAATCGTAGCCATCCGGACAGTGTGCACGATCGTACATGCTACGTG

CAGATGCATTAGCATCGGTAGGCCTGTCACACGTGCTAGCATGTACGATGCAC

Suspect 3 DNA Suspect 3 DNA Suspect 3 DNA Suspect 3 DNA Suspect

GTCGACCGGTGACCGTGCGTACACAGTGCTCCGGATAGCTGATAGCTCCGGTG

CAGCTGGCCACTGGCACGCATGTGTCACGAGGCCTATCGACTATCGAGGCCAC

Suspect 4 DNA Suspect 4 DNA Suspect 4 DNA Suspect 4 DNA Suspect GTCTCCATCCGGACTACCATACATCTGGTGTACCCGGTGATATCGTCCGGGTG

CAGAGGTAGGCCTGATGGTATGTAGACCACATGGGCCACTATAGCAGGCCCAC

................
................

In order to avoid copyright disputes, this page is only a partial summary.

Google Online Preview   Download