DNA Transcription & Translation Homework Assignment
Molecular Genetics - Transcription and Translation Homework Assignment
Name: _____________________________________________
1. Completely define genetic:
Transcription –
Translation –
2. Below is a picture of DNA “unzipping” and going through transcription. Show the resulting RNA molecule by writing in the appropriate complementary base pairs within the replication fork depicted.
[pic]
3. You will now practice translating the genetic code into chains of amino acids (proteins). Use the table on the next page to translate each codon in the following example from the original language of DNA into the appropriate sequenced of amino acids. See the following example.
Example - Translate the following DNA sequence:
ATGGAAAATTGGCTTCTGTGTAGGTATACCTATGATTAG
Answer - Divide the DNA sequence into triplets:
ATG-GAA-AAT-TGG-CTT-CTG-TGT-AGG-TAT-ACC-TAT-GAT-TAG
And assign the correct amino acid for each triplet based on the table below:
Met (START)-Glu-Asn-Trp-Leu-Leu-Cys-Arg-Tyr-Thr-Tyr-Asp-STOP
When you reach a terminator triplet, you need to end the amino acid chain and start a new one.
Translate the following two sequences yourself:
a. ATGGACGTATAGATGACAGGTAGATGTTTCAGGGGGATTTATCGATAG
b. ATGGCCATTGAGTGTCAAAAGTCTCAATGA
Table of Standard Genetic Code
| |T |C |A |G |
|T |TTT Phe (F) |TCT Ser (S) |TAT Tyr (Y) |TGT Cys (C) |
| |TTC Phe (F) |TCC Ser (S) |TAC |TGC |
| |TTA Leu (L) |TCA Ser (S) |TAA STOP |TGA STOP |
| |TTG Leu (L) |TCG Ser (S) |TAG STOP |TGG Trp (W) |
|C |CTT Leu (L) |CCT Pro (P) |CAT His (H) |CGT Arg (R) |
| |CTC Leu (L) |CCC Pro (P) |CAC His (H) |CGC Arg (R) |
| |CTA Leu (L) |CCA Pro (P) |CAA Gln (Q) |CGA Arg (R) |
| |CTG Leu (L) |CCG Pro (P) |CAG Gln (Q) |CGG Arg (R) |
|A |ATT Ile (I) |ACT Thr (T) |AAT Asn (N) |AGT Ser (S) |
| |ATC Ile (I) |ACC Thr (T) |AAC Asn (N) |AGC Ser (S) |
| |ATA Ile (I) |ACA Thr (T) |AAA Lys (K) |AGA Arg (R) |
| |ATG Met (M) START |ACG Thr (T) |AAG Lys (K) |AGG Arg (R) |
|G |GTT Val (V) |GCT Ala (A) |GAT Asp (D) |GGT Gly (G) |
| |GTC Val (V) |GCC Ala (A) |GAC Asp (D) |GGC Gly (G) |
| |GTA Val (V) |GCA Ala (A) |GAA Glu (E) |GGA Gly (G) |
| |GTG Val (V) |GCG Ala (A) |GAG Glu (E) |GGG Gly (G) |
|Key to the Table of Standard Genetic Code |
|Alanine |ALA | | |Arginine |ARG | |
|Asparagine |ASN | | |Aspartic acid |ASP | |
|Cysteine |CYS | | |Glutamic acid |GLU | |
|Glutamine |GLN | | |Glycine |GLY | |
|Histidine |HIS | | |Isoleucine |ILE | |
|Leucine |LEU | | |Lysine |LYS | |
|Methionine |MET | | |Phenylalanine |PHE | |
|Proline |PRO | | |Serine |SER | |
|Threonine |THR | | |Tryptophan |TRP | |
|Tyrosine |TYR | | |Valine |VAL | |
|STOP = Termination Signal START = Start codon (ATG) |
................
................
In order to avoid copyright disputes, this page is only a partial summary.
To fulfill the demand for quickly locating and searching documents.
It is intelligent file search solution for home and business.
Related download
- dna replication transcription translation and mutation
- replication protein synthesis quiz
- from gene to protein—transcription and translation
- dna coloring transcription translation
- protein synthesis worksheet hartland high school
- transcripton translation worksheet
- dna transcription translation homework assignment
- dna replication transciption translation
- from gene to protein transcription and translation
Related searches
- transcription translation animation
- dna transcription and translation simplified
- dna replication transcription translation worksheet
- transcription translation khan academy
- dna transcription and translation worksheet
- transcription translation summary
- transcription translation activity
- transcription translation practice worksheet answer key
- transcription translation worksheet answers
- transcription translation practice answer key
- dna transcription translation quiz
- dna transcription and translation examples