DO NOT WRITE ON THIS PAGE



DO NOT WRITE ON THIS PAGE!!!

Protein Synthesis Lab

Background

DNA carries the information for the synthesis of all the proteins of an organism. Protein molecules are large and complex, composed of hundreds of amino acids; amino acids are the subunits (building blocks) of protein. The combination of amino acids will determine the type of protein that gets made. The protein molecule is determined by the genetic code within the DNA sequence of the organism. There are 20 amino acids that combine differently to form structures like hair, nail, muscles, tissues, enzymes, and pigments. These 20 amino acids are used by humans, fish, bacteria, plants, insects… basically all living organisms! Answer question #1 on your Answer Sheet!!!

The first step of protein synthesis called Transcription. In transcription, the DNA of an organism is used as a template to create a complementary mRNA (messenger RNA) strand. The mRNA moves out of the nucleus and into the cytoplasm to begin the process of translation.

Translation is the second step of protein synthesis. During translation, ribosomes in the cytoplasm temporarily attach to the mRNA to read the codons on the mRNA. Codons code for specific amino acids. The amino acids are then transported to the ribosome by tRNA (transfer RNA); the tRNA has an anticodon, which is a series of 3 bases, which match with the codon on the mRNA. As the ribosome moves along the mRNA reading each codon, the appropriate amino acid is brought into place.

The order of amino acids in the protein is translated from the mRNA which in turn is transcribed from the DNA.

Objectives

In this activity you will:

1. Follow the steps of protein synthesis.

2. Translate the genetic code for specific amino acids.

3. Use paper models to simulate protein synthesis.

4. Make observations of your model and make inferences about mutations.

Materials

Tape Scissors Codon Table

Procedure

1. Write down the group you have been assigned in the appropriate space on the upper, left-corner of your Answer Sheet.

2. Color the amino acids attached to each tRNA based based on the key provided below (only color the amino acid, DO NOT color the anticodon on the tRNA):

3. Cut out the mRNA strips and tape them together in the correct order (segments 1-3).

4. Read the first codon on the mRNA and find the corresponding anticodon on the tRNA.

5. Cut out the corresponding tRNA, DO NOT cut off the amino acid from the tRNA yet!

6. Match the bases of the codon to the anticodon and tape them together. Use small amounts of tape!

7. Repeat steps 3-6 for the remaining codons on the mRNA.

8. When you are done translating the mRNA, carefully tape together the amino acids (colored parts) using small pieces of tape.

9. Before you proceed to the next step, your teacher will pair you with another group. Compare your amino acid chains as well as the sequence of nitrogen bases in the mRNA. Read through the information about mutations on page p298-299 in your textbook. Answer question #2 on your Answer Sheet!!!

10. Cut the amino acid chain off. Remember, at the end of translation the ribosome detaches from the mRNA and the amino acid chain is released to be used to make protein!!! The amino acid chain would not be functional if the RNA stayed attached to it.

11. Staple your amino acid chain to the appropriate spot on your Answer Sheet.

12. Answer the questions on your Answer Sheet, complete the Self and Peer Assessments last.

CODON TABLE

[pic]

Name(s): ______________________________________________________________________

Period: __________ Date: __________________________

Answer Sheet: Protein Synthesis Lab

1. Explain what you think it says about all life on Earth that all organisms share the same 20 amino acids. ____________

____________________________________________________________________________________________________________________________________________________________________________________________

2. Based on your observations, describe the mRNA difference between Group A and Group B. ____________________

______________________________________________________________________________________________

Infer and determine what type of mutation this is. ______________________________________________________

Describe how this type of mutation affected the sequence of amino acids in the chain from Group A and Group B. ______________________________________________________________________________________________

______________________________________________________________________________________________

MORE MODELING PRACTICE…

3. Define transcription. _____________________________________________________________________________

Where in the cell does transcription occur? ___________________________________________________________

4. Define translation. _______________________________________________________________________________

Where in the cell does translation occur? _____________________________________________________________

5. One strand of DNA has the base sequence CGATTGGCAGTCATA. Determine the sequence of mRNA that would form using this DNA as a template. _________________________________________________________________

6. What organelle is involved with translation? __________________________________________________________

7. Using the codon table in your instructions or in your book to read the codons below. Find the name of the amino acid and write the abbreviated name for it in the space provided. If the letters code for more than one amino acid, separate the names with dashes (ex: Met – Leu).

a. UUA ___________________________________________________________________________________

b. UAUCUA ______________________________________________________________________________

c. AAGAGUUCG __________________________________________________________________________

d. CCAGCUAGAGGGUGGCUGUCA

________________________________________________________________________________________

8. Determine the anti-codon for each codon below. Write it in the space provided.

a. GGU _________________

b. CGC _________________

c. AUG _________________

9. Use the DNA below to sequence a complementary RNA strand.

GTATACCAGTCATTTGTC

______________________________________________________________________________________________

10. Use the RNA you just sequenced to figure out the order of amino acids. Write the abbreviate name of each amino acid and separate each amino acid with a dash.

______________________________________________________________________________________________

11. Sometimes a mistake occurs in the translation of an mRNA strand. Suppose that the reading of the mRNA strand you sequenced in #9 mistakenly began at the second nucleotide base instead of the first (the first codon will then be AUA). Write the order of amino acids coded for by the new codons.

______________________________________________________________________________________________

12. Suppose the bases of the DNA strand in #9 were not transcribed correctly, and the mRNA incorrectly reads as:

CACAUGGUUAGUAAGCAG

a. How many mistakes were made in the transcription? __________________________

b. Write the order of the amino acids coded for by the incorrect mRNA. Use the abbreviations and separate the amino acids with a dash.

___________________________________________________________________________________________

13. Reverse Transcribe (RNA(DNA) the DNA sequence that was used to make the mRNA below.

UUUGACAUGGGCUGUAAC

______________________________________________________________________________________________

14. If a mistake gets made during transcription (DNA ( RNA), explain how that affects the RNA sequence.

____________________________________________________________________________________________________________________________________________________________________________________________

15. If the RNA was transcribed incorrectly, explain how that affects translation (RNA ( Protein) and the protein’s ability to function. _____________________________________________________________________________________

______________________________________________________________________________________________

16. Amino acids are the subunit (building block) of _______________________________________________________.

17. If there is a mutation in the DNA sequence, explain how that will affect the RNA the gets made during transcription and how it will affect the amino acid chain that gets made in translation. How will the functioning of the proteins made with these amino acid chains be affected? _______________________________________________________

____________________________________________________________________________________________________________________________________________________________________________________________

18. Explain why the RNA has to separate from the amino acid chain at the end of translation. (Hint: what is a protein made of, does it have nucleic acid in it?) _____________________________________________________________

______________________________________________________________________________________________

19. What kind of RNA are codons are found on? ___________________________________

20. What kind of RNA are anti-codons are found on? _______________________________

21. Explain how a mutation in the DNA sequence can affect transcription and translation. _________________________

____________________________________________________________________________________________________________________________________________________________________________________________

COMPLETE AT THE VERY END…

|Self Assessment |

| |0 |1 |2 |

|How hard did you work on this assignment? | | | |

|How well did you work with your partner? | | | |

|How much did you contribute to the work? | | | |

|Peer Assessment |

| |0 |1 |2 |

|How hard did your partner work on this assignment? | | | |

|How well did your partner work with you partner group? | | | |

|How much did your partner contribute to the work? | | | |

-----------------------

cys-blue ala-red ser-orange leu-black asn-yellow tyr-green

gln-brown glu-purple val-leave white gly-yellow stripes ile-green stripes

GROUP: ____________

------------ Staple the end of your Amino Acid chain on the dotted line, use 1 staple.

................
................

In order to avoid copyright disputes, this page is only a partial summary.

Google Online Preview   Download