Supplemental Figures and Tables:



Supplemental Figures and Tables:

Supplemental Data Figure Legends

S-Fig 1. The isolation of the 1.6-kb DNA sequence, p1130, up-regulated in EP1130. The DNA sequence represents the 1.6-kb DNA (p1130) isolated by 5’ and 3’ RACE based on the initial primers (labeled in yellow) that amplify the up-regulated transcript in EP1130 by RT-PCR. The DNA sequence in between the yellow-labeled DNA sequences is the up-regulated transcript amplified by RT-PCR shown in the first row of figure 1D. The 5’ and 3’ RACE were carried out by the GeneRacerTM kit from Invitrogen (Cat. #: L1500-01). The information of the subsequent nested primers is available upon request. The DNA sequence in red perfectly matches the 3’UTR of CG32684 by the BLAST search analysis.

S-Fig 2. EP1307 mutant in alpha-1,2-mannosidase I (mas1) exhibits a longer lifespan. EP1307 was isolated as a stress resistant mutant in using 20 mM paraquat in 5% sucrose water and subsequently tested for lifespan at 25°C. Three repeats were performed with a cohort of 197 w1118 flies and 253 EP1307 flies. The calculated mean lifespan is 48 days for w1118 and 58 days for EP1307. PUAS-CG32684RNAi knockdowned flies and the control da-GAL4/+ female flies on the abundant (15%SY) and restricted (5%SY) food was measured at 25°C. No significant lifespan enhancement was observed in da-GAL4>UAS-CG32684RNAi knockdowned flies under the restricted food compared to the abundant food. A dashed grey line represents the lifespan curve of da-GAL4/+ on the restricted food, dashed black line is that of da-GAL4/+ on the abundant food, solid grey line is the lifespan curve of da-GAL4>UAS-CG32684RNAi knockdowned flies on the restricted food, solid black line is that of da-GAL4>UAS-CG32684RNAi flies on the abundant food.

S-Fig 5. A similar pattern of reduced fecundity of the mutant and control flies in the restricted (5%SY) food compared to the abundant (15%SY) food. Ten mated female flies were collected to place in a cage to lay eggs on a plate containing either 5% sugar/yeast (SY) or 15% SY fly food for 24 hours. A new plate was replaced every 24 hours for four consecutive days. The average egg number per fly is calculated from the egg number of ten flies with two repeats. Grey square represents the average egg number per fly in the 5% SY fly food, solid diamond is that in the 15% SY fly food.

Supplemental Figure 1.

p1130 DNA sequence:

5’ - TGGTCTGGTCTGGCGGGCTCGTCTAGTCTGCTCGACAAAGAAGAG

CGAATGAGAGGGAAAACGACCGGTCTGATATGGTACACTAAAAGAAACGTCAAGCTACTTTCTGATTTATATGCCGAAAAATCACTTTTAATGCGAGGTGGCCACTGGCATGGTAAACTATGTCGGCAAAGTCAAAGCTACAGTTTTAAATCCATAAAATGGTAAAATCTTTCCCTCTGAGAGAGATCCTGTTATATTTCTTTGGGTGTACTCTCTCGCATGCTTGTTCTCGCATTTTTTTGGAAGTGGGCGGTGGGTGGCGAATGCAATCGCCAGTTGGCACTCCTCCATTTTATCGTTATGCTTTGTTCGCATTCGATTCAGCGTTTTACTGCCCCTTCTTCTGAGGATCTTATGCTGGCAAAATTTGGACTTTGCACGACAATCGGATGTTAACCCATTACGTTAAAAAATCCATTTTAAATGTACATATATGTATATCTATATTTAGAAAACTCTTTCCCAAAGCAATATATTTTTTAAGCTTCGAATTTTTGATATGTATCTACATATATCTAAAGAGTATTTCTTGAACAATCATGATTCAAGGGGTTAATCGAAGTGGCTGGAAGGGTGGATATGTCGCGACGAACTCCCTTTCCGGGTTCTCGAATCGCCAGCGAATGTTGTTAACCTCACATTGTGCTTTGTGTGTTCGCCTTTTGTGCAAGTTTCTTCATTAAGTATACGCACATTCGGTTTAAGTGGACTGCTCATTAATTGAGCTCGACAACTGCTCGTGAAGTGGCTTGTGTGGCAGATACATAAATATATCTGAAAGTGGAATCAGCGGGTTATGGGGGGGCACTAGTTTATAGTCTGACAAACTATCAATGAGCTATCAATGTGCTGCGAGATAAAAATGTTTTTACAAAGAAAGAGCTGAATAAGCGGTGAATTTTCCAACATTACGTATGAGAGTATAATAAAATATGCATATTTTCAAACCTTTTTTAAAGCATTTGAGTACCGTAAGAATGAAATAAATAACGCACAGTTATAAGTTAATTATTAGATCTTTATTAAACTTATGATTTAGGCAAAATACACGTGACATCTCCAGCAGCTCAGGGACTGCTATTGATGAATGTATTGTGTCTGATGCATTTACAAACTGCCATTCGAATCTGTGTGTTCGGCATTATAATCGGATATATTATATATCTCGCTATTGGCCTCAATTTCTAATTTGATCTAAACAAAAAAAGGTTTGCTCTAGAGACTAAATTTATGCTTAATTAGTATCGAATTCATTCTTTTCTTCCTATTCTTTTTAAGCATTTAGCTCGTTTAACGTTTGTTAGCTTGGGTTTATTAGATTTCTTCATTTATCGGGTTAAATCATTTTGATATTATTTTATTTTGTTAAAATGTTTCTTTAAAATTCTTTTGTTTTACATTAGGGTCTTAGCTTATGTTTTATGTTATTTTTACGTTTGTTAAATCACTTTACACAGAACAAGCTGTGTATGTTACAA - 3’

Supplemental Figure 2.

[pic]

Supplemental Figure 3.

[pic]

Supplemental Figure 4.

[pic]

Supplemental Figure 5.

[pic]

|Supplemental table 1. A summary of the lifespan of the male mutants at 25°C |

|Strain ♂ |Sample size |Mean lifespan |Increase |P-value |

|w1118 |363 |38 | | |

|EP1130 |313 |53 |38% | ................
................

In order to avoid copyright disputes, this page is only a partial summary.

Google Online Preview   Download