DNA Discovery, Structure, Replication, Transcription ...
Name________________________________________________per____Date___________________
DNA Structure, Replication, Transcription, Translation and Mutation Unit Review
1. Identify the contribution of each of the following scientists to the discovery of DNA.
a. Chargaff b. Wilkins and Franklin
c.. Watson and Crick
2. Draw a nucleotide of DNA and identify the three parts
3. Identify the 4 nitrogen bases found in DNA
a. b. c. d.
4. Use the base pairing rules to correctly match the nitrogen bases together.
________________pairs with_______________; ________________pairs with ______________
11. For each process below, identify where it occurs in the cell, what is produced and why the process is necessary
Replication:
Transcription:
Translation:
12. The process of replication is described as semi-conservative. What does this mean?
13. Describe the role of complementary base pairing in DNA Replication
14.Explain the replication of DNA. Include the role of DNA polymerase, replication bubbles, and the replication fork.
15. List three differences between DNA and RNA
a.
b.
c.
16. Identify 3 types of RNA, where they are found and what they do.
a.
b.
c.
17. What is produced by transcription?
18. Explain why transcription is necessary.
19. What is the relationship between codons and amino acids?
20. Explain the transcription of DNA. Include the role of DNA, the promoter, RNA polymerase, terminator, mRNA
21. Explain what introns and exons are.
Use the diagrams below to answer questions 22 - 33 in relation to protein synthesis.
[pic]
22. What process is represented by diagram 1?
23. What process is represented by diagram 2?
24. What is labeled at A?
25. What is labeled at B?
26. What is labeled at C?
27. What is labeled at D?
28. What is labeled at E?
29. What is labeled at F, G and H?
30. What is labeled at I?
31. What is labeled at J?
32. What is labeled at K?
33. What is labeled at L?
34. Explain what happens in translation. Include the role of mRNA, the ribosome, tRNA, amino acids, the start codon, mRNA codons, tRNA anti-codons
35. Define triplet, codon and anti-codon
triplet:
codon:
anti-codon:
36. Use your codon chart on to complete the table below.
|DNA Triplet | | | TTC | |
|mRNA codon | | | | UAG |
|tRNA anti-codon | | CAG | | |
|Amino acid coded | met | | | |
37. Using the following DNA sequences, identify each of the following: Point mutation and frameshift mutations : insertion and deletion
Original: TACGCCAGCCCGAGCTATAAAATT
Mutation 1: TACGCAGCCCGAGCTATAAAATT
Mutation 2: TACGCCAGCCCGAACTATAAAATT
Mutation 3: TACGCCATGCCCGAGCTATAAAATT
38. Which mutations above would have the have the greatest impact on an organism? Why?
-----------------------
Match the letter with the corresponding phrase:
5. Identify a nucleotide of DNA.
6. Identify the labeled deoxyribose sugar.
7. Identify all of the labeled nitrogen bases.
8. Identify a labeled phosphate group.
9. Identify all of the labeled purines.
10. Identify the labeled hydrogen bonds.
A
B
C
D
................
................
In order to avoid copyright disputes, this page is only a partial summary.
To fulfill the demand for quickly locating and searching documents.
It is intelligent file search solution for home and business.
Related download
- from gene to protein transcription and translation
- replication transcription translation lecture
- dna replication transcription translation and mutation
- dna replication transcription and translation quiz
- dna discovery structure replication transcription
- dna rna replication transcription and translation
- translation and transcription and replication oh my
Related searches
- dna replication transcription and translation
- dna replication steps khan academy
- dna replication vs transcription translation
- khan academy dna replication video
- compare dna replication and transcription
- dna replication transcription translation worksheet
- replication transcription and translation key
- dna structure and replication worksheet answer key
- dna replication khan
- dna replication khan academy
- dna structure and replication pogil
- dna structure and replication answer key